\
| Variant ID: vg0133079922 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 33079922 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AGGTGAGACCTCTATACCCGGTTTTACTATCACACCATAAATGTTTTCTCTATATTAAAGTCCTGATACATATAATTCTAATGAAGTATTTCTACTATAT[C/A]
TATTTTTTTCAAGGAATAACATAACCTCTATACTCGGTTTTACTATCACACCATAAATGTTTTCTCTATATTAAAGTCCTGGTACATATAATTCTAATGA
TCATTAGAATTATATGTACCAGGACTTTAATATAGAGAAAACATTTATGGTGTGATAGTAAAACCGAGTATAGAGGTTATGTTATTCCTTGAAAAAAATA[G/T]
ATATAGTAGAAATACTTCATTAGAATTATATGTATCAGGACTTTAATATAGAGAAAACATTTATGGTGTGATAGTAAAACCGGGTATAGAGGTCTCACCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.50% | 20.00% | 3.47% | 4.08% | NA |
| All Indica | 2759 | 99.00% | 0.80% | 0.11% | 0.11% | NA |
| All Japonica | 1512 | 25.00% | 53.50% | 10.12% | 11.38% | NA |
| Aus | 269 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.80% | 0.70% | 0.33% | 0.22% | NA |
| Indica Intermediate | 786 | 98.00% | 1.90% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 43.20% | 42.00% | 8.47% | 6.39% | NA |
| Tropical Japonica | 504 | 4.00% | 65.30% | 13.29% | 17.46% | NA |
| Japonica Intermediate | 241 | 11.20% | 65.60% | 8.71% | 14.52% | NA |
| VI/Aromatic | 96 | 5.20% | 76.00% | 3.12% | 15.62% | NA |
| Intermediate | 90 | 55.60% | 35.60% | 5.56% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0133079922 | C -> A | LOC_Os01g57240.1 | upstream_gene_variant ; 954.0bp to feature; MODIFIER | silent_mutation | Average:36.797; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| vg0133079922 | C -> A | LOC_Os01g57250.1 | upstream_gene_variant ; 2155.0bp to feature; MODIFIER | silent_mutation | Average:36.797; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| vg0133079922 | C -> A | LOC_Os01g57240-LOC_Os01g57250 | intergenic_region ; MODIFIER | silent_mutation | Average:36.797; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| vg0133079922 | C -> DEL | N | N | silent_mutation | Average:36.797; most accessible tissue: Minghui63 root, score: 65.927 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0133079922 | NA | 1.00E-13 | mr1070 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 2.46E-11 | mr1084 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 2.45E-10 | mr1097 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 1.15E-14 | mr1128 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 9.15E-15 | mr1164 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 2.00E-13 | mr1205 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 2.28E-06 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 1.22E-10 | mr1302 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 7.24E-08 | mr1315 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 1.26E-10 | mr1332 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 1.71E-07 | mr1392 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 6.40E-06 | mr1418 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 2.00E-07 | mr1420 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 1.10E-08 | mr1488 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 9.39E-08 | mr1506 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 3.46E-06 | mr1507 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 4.78E-08 | mr1508 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 7.36E-14 | mr1521 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 6.15E-23 | mr1580 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 9.19E-09 | mr1604 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 5.17E-21 | mr1627 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 4.95E-14 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 1.88E-11 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 1.97E-07 | mr1764 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 2.27E-13 | mr1775 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 2.74E-08 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 2.01E-10 | mr1779 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 1.01E-06 | mr1797 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 1.01E-06 | mr1801 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 3.58E-10 | mr1810 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 2.01E-08 | mr1824 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 3.84E-17 | mr1825 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 2.70E-21 | mr1838 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 6.36E-07 | mr1886 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 1.15E-09 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 8.33E-13 | mr1097_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 1.21E-16 | mr1128_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 2.43E-16 | mr1148_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 1.42E-07 | mr1164_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 1.13E-08 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 1.64E-08 | mr1205_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 4.31E-07 | mr1302_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 4.80E-07 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 4.23E-10 | mr1506_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 3.01E-14 | mr1521_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 9.52E-08 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 8.45E-22 | mr1627_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 8.68E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 2.28E-10 | mr1646_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 1.68E-08 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 5.21E-06 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0133079922 | NA | 2.97E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |