Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131776643:

Variant ID: vg0131776643 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31776643
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, G: 0.00, others allele: 0.00, population size: 313. )

Flanking Sequence (100 bp) in Reference Genome:


AGCGCGTCTGCAAGTTGCTAGCTGTTTATGAGGTGTTTGGAAAAAAAAATCTCTACTTAGCGTGATGGATCTTTTGATCAGGCGACGGATTCAGTCATTA[A/G]
TATCGGGAAACAACCGCGCGGCTGAATTTCTGTTTCTTTTCTTTCCGAGAGAGAACAATTCCGGGTCGATCACGAATCACACAACACACGTATATGTAAT

Reverse complement sequence

ATTACATATACGTGTGTTGTGTGATTCGTGATCGACCCGGAATTGTTCTCTCTCGGAAAGAAAAGAAACAGAAATTCAGCCGCGCGGTTGTTTCCCGATA[T/C]
TAATGACTGAATCCGTCGCCTGATCAAAAGATCCATCACGCTAAGTAGAGATTTTTTTTTCCAAACACCTCATAAACAGCTAGCAACTTGCAGACGCGCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 6.50% 0.11% 0.00% NA
All Indica  2759 99.70% 0.30% 0.00% 0.00% NA
All Japonica  1512 81.10% 18.80% 0.13% 0.00% NA
Aus  269 99.30% 0.40% 0.37% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 98.80% 1.00% 0.13% 0.00% NA
Tropical Japonica  504 47.20% 52.60% 0.20% 0.00% NA
Japonica Intermediate  241 95.40% 4.60% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 16.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131776643 A -> G LOC_Os01g55220-LOC_Os01g55240 intergenic_region ; MODIFIER silent_mutation Average:83.948; most accessible tissue: Minghui63 flower, score: 97.297 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0131776643 A G -0.05 0.0 -0.01 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0131776643 NA 4.33E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131776643 NA 2.49E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131776643 NA 3.21E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131776643 NA 1.95E-06 mr1543 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131776643 NA 2.53E-09 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131776643 NA 3.99E-07 mr1668 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131776643 NA 3.55E-07 mr1671 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131776643 5.43E-10 1.21E-19 mr1871 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131776643 NA 3.58E-08 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131776643 NA 1.20E-13 mr1410_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0131776643 NA 1.88E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251