Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0131433190:

Variant ID: vg0131433190 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 31433190
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCTGCTCCGGGTCCAGCGGCGCCGCTCCGGCGAAGGAGATGGCGACGAGTAGTAGTAGCAGCAGCAGTAGGTCGTGCGTGGCGAGGACGGTGGTGGTGG[T/C]
GGCGGCGGCCATGCTCTTGGACGCAGAGGCGAAGAGCAGGCACGGGCTCACGCCGAGAAATGTTTCAAAGGGTGGGTGCGCGGGTGCGCGCGCGGTTTCC

Reverse complement sequence

GGAAACCGCGCGCGCACCCGCGCACCCACCCTTTGAAACATTTCTCGGCGTGAGCCCGTGCCTGCTCTTCGCCTCTGCGTCCAAGAGCATGGCCGCCGCC[A/G]
CCACCACCACCGTCCTCGCCACGCACGACCTACTGCTGCTGCTACTACTACTCGTCGCCATCTCCTTCGCCGGAGCGGCGCCGCTGGACCCGGAGCAGCT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.50% 12.50% 0.00% 0.00% NA
All Indica  2759 78.60% 21.40% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 95.80% 4.20% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 56.20% 43.80% 0.00% 0.00% NA
Indica Intermediate  786 80.80% 19.20% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0131433190 T -> C LOC_Os01g54630.1 missense_variant ; p.Thr5Ala; MODERATE nonsynonymous_codon ; T5A Average:97.242; most accessible tissue: Zhenshan97 panicle, score: 99.519 unknown unknown TOLERATED 0.31

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0131433190 T C -0.02 0.02 0.03 -0.07 -0.04 -0.01