Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0129888300:

Variant ID: vg0129888300 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 29888300
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTCTAAATTTGACGCCGTTGACTTTTTTAAATATATATGACCGTTTGTTTTATTAAAAAATCTAAATTTGACGCCGTTGACTTTTTTAAATATATATGAC[C/T]
GTTTGTCTTATTAAAAAATTTAAGTAATTATTAATTCTTTTTCTATCATTTGATTCATTGATAAATATATTTTTATGTATACGTATAGTTTTACATATTT

Reverse complement sequence

AAATATGTAAAACTATACGTATACATAAAAATATATTTATCAATGAATCAAATGATAGAAAAAGAATTAATAATTACTTAAATTTTTTAATAAGACAAAC[G/A]
GTCATATATATTTAAAAAAGTCAACGGCGTCAAATTTAGATTTTTTAATAAAACAAACGGTCATATATATTTAAAAAAGTCAACGGCGTCAAATTTAGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.20%	3.00%	2.09%	0.61%	NA
All Indica	2759	97.80%	0.10%	0.98%	1.05%	NA
All Japonica	1512	86.80%	8.80%	4.37%	0.00%	NA
Aus	269	97.40%	1.90%	0.74%	0.00%	NA
Indica I	595	99.50%	0.00%	0.00%	0.50%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	96.50%	0.10%	1.31%	2.08%	NA
Indica Intermediate	786	96.80%	0.40%	1.91%	0.89%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	62.90%	25.00%	12.10%	0.00%	NA
Japonica Intermediate	241	95.40%	2.50%	2.07%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	95.60%	1.10%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0129888300	C -> T	LOC_Os01g52000.1	upstream_gene_variant ; 2198.0bp to feature; MODIFIER	silent_mutation	Average:29.987; most accessible tissue: Callus, score: 63.435	N	N	N	N
vg0129888300	C -> T	LOC_Os01g52000-LOC_Os01g52010	intergenic_region ; MODIFIER	silent_mutation	Average:29.987; most accessible tissue: Callus, score: 63.435	N	N	N	N
vg0129888300	C -> DEL	N	N	silent_mutation	Average:29.987; most accessible tissue: Callus, score: 63.435	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0129888300	NA	3.30E-06	mr1154	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	NA	1.39E-07	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	NA	7.84E-11	mr1539	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	NA	1.14E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	NA	7.89E-08	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	NA	5.81E-07	mr1723	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	NA	8.17E-16	mr1732	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	NA	3.90E-07	mr1097_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	NA	4.54E-07	mr1206_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	NA	7.99E-06	mr1428_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	7.20E-07	NA	mr1539_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	NA	2.24E-17	mr1539_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	2.15E-07	NA	mr1540_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	NA	3.32E-19	mr1540_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	NA	1.17E-06	mr1596_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	NA	4.91E-09	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	1.10E-06	NA	mr1715_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	NA	1.06E-06	mr1715_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	NA	3.65E-06	mr1723_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	5.32E-07	NA	mr1732_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0129888300	NA	1.51E-17	mr1732_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251