\
| Variant ID: vg0128850364 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 28850364 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTTGGAAGTTTGAAGAAAAATTTTATAACTAAACACGGCCTTGATGTGATGGAAAAGTTAGAAGTTTGAAGAAAATTTTTGGAACTATGTGTTTAGTTCA[C/T]
GCTAAAATTTAAAGTTTTATTAAAATTGGAACAATGTGATAAAAAAGTTGAAAATTTTAAGAAAAAACGAGCATGGTGGCCCGCGCAGATTGCACGGCCA
TGGCCGTGCAATCTGCGCGGGCCACCATGCTCGTTTTTTCTTAAAATTTTCAACTTTTTTATCACATTGTTCCAATTTTAATAAAACTTTAAATTTTAGC[G/A]
TGAACTAAACACATAGTTCCAAAAATTTTCTTCAAACTTCTAACTTTTCCATCACATCAAGGCCGTGTTTAGTTATAAAATTTTTCTTCAAACTTCCAAC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.90% | 3.90% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 90.10% | 9.50% | 0.46% | 0.00% | NA |
| Aus | 269 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.70% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 74.80% | 24.20% | 0.99% | 0.00% | NA |
| Japonica Intermediate | 241 | 93.40% | 6.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 10.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0128850364 | C -> T | LOC_Os01g50190.1 | upstream_gene_variant ; 3421.0bp to feature; MODIFIER | silent_mutation | Average:40.024; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0128850364 | C -> T | LOC_Os01g50200.1 | upstream_gene_variant ; 540.0bp to feature; MODIFIER | silent_mutation | Average:40.024; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0128850364 | C -> T | LOC_Os01g50220.1 | downstream_gene_variant ; 4385.0bp to feature; MODIFIER | silent_mutation | Average:40.024; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0128850364 | C -> T | LOC_Os01g50200-LOC_Os01g50220 | intergenic_region ; MODIFIER | silent_mutation | Average:40.024; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0128850364 | NA | 5.54E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128850364 | NA | 4.46E-06 | mr1217_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128850364 | NA | 1.95E-06 | mr1633_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0128850364 | 1.07E-06 | 9.07E-09 | mr1696_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |