Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128797659:

Variant ID: vg0128797659 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 28797659
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 318. )

Flanking Sequence (100 bp) in Reference Genome:

ATGACCGGTGATGTGTATGTGATGGAAGAAAACGTATGTACGACTTAATGCTTGCACCTATACTACTGCTGTGTGCATTATTCGAGTGATCAATTTGAGC[A/G]
TTTGCAGCTCACAACCCTGCAGGTTTGTCTGTCTATATATGCACGTATGCGCAGCTCATTAGTGTTATTTTTTTGTTTGCTACATCTGTTCTTATTCCAG

Reverse complement sequence

CTGGAATAAGAACAGATGTAGCAAACAAAAAAATAACACTAATGAGCTGCGCATACGTGCATATATAGACAGACAAACCTGCAGGGTTGTGAGCTGCAAA[T/C]
GCTCAAATTGATCACTCGAATAATGCACACAGCAGTAGTATAGGTGCAAGCATTAAGTCGTACATACGTTTTCTTCCATCACATACACATCACCGGTCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.80%	29.20%	0.00%	0.00%	NA
All Indica	2759	98.80%	1.20%	0.00%	0.00%	NA
All Japonica	1512	15.50%	84.50%	0.00%	0.00%	NA
Aus	269	92.90%	7.10%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	97.20%	2.80%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	97.80%	2.20%	0.00%	0.00%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	41.50%	58.50%	0.00%	0.00%	NA
Japonica Intermediate	241	7.50%	92.50%	0.00%	0.00%	NA
VI/Aromatic	96	86.50%	13.50%	0.00%	0.00%	NA
Intermediate	90	56.70%	43.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128797659	A -> G	LOC_Os01g50110.1	3_prime_UTR_variant ; 172.0bp to feature; MODIFIER	silent_mutation	Average:69.424; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N
vg0128797659	A -> G	LOC_Os01g50100.1	upstream_gene_variant ; 4359.0bp to feature; MODIFIER	silent_mutation	Average:69.424; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N
vg0128797659	A -> G	LOC_Os01g50120.1	upstream_gene_variant ; 1215.0bp to feature; MODIFIER	silent_mutation	Average:69.424; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N
vg0128797659	A -> G	LOC_Os01g50120.2	upstream_gene_variant ; 1215.0bp to feature; MODIFIER	silent_mutation	Average:69.424; most accessible tissue: Zhenshan97 young leaf, score: 80.325	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128797659	NA	8.49E-86	mr1334	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797659	NA	3.47E-36	mr1486	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797659	NA	3.63E-22	mr1548	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797659	NA	8.75E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797659	NA	1.91E-25	mr1805	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797659	NA	1.34E-97	mr1334_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797659	NA	6.28E-18	mr1682_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797659	NA	3.06E-21	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797659	NA	3.43E-17	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797659	NA	4.66E-43	mr1805_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797659	NA	1.95E-15	mr1866_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797659	NA	6.35E-55	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251