Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0128797210:

Variant ID: vg0128797210 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 28797210
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.90, T: 0.09, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

GCCGCCACTTCTTACAAGAAGGCGGTGCCGGCCAAGCCGCCGAGGACGGCATCCTCGCCGGCCGCTGGCATTGAGTGCAGCGACGATCGTGCCCGACCGG[C/T]
CGACGGTGGCGGTGACTTCGCAGCGATGGTGAGCGCCGCCGATGCCGAGGGATTCGAAGGAGGATTTGGCGATCAGTTCTGTGCCGAGGATGCAGTTCAT

Reverse complement sequence

ATGAACTGCATCCTCGGCACAGAACTGATCGCCAAATCCTCCTTCGAATCCCTCGGCATCGGCGGCGCTCACCATCGCTGCGAAGTCACCGCCACCGTCG[G/A]
CCGGTCGGGCACGATCGTCGCTGCACTCAATGCCAGCGGCCGGCGAGGATGCCGTCCTCGGCGGCTTGGCCGGCACCGCCTTCTTGTAAGAAGTGGCGGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.50%	39.40%	0.13%	0.00%	NA
All Indica	2759	93.90%	5.90%	0.14%	0.00%	NA
All Japonica	1512	8.00%	92.00%	0.00%	0.00%	NA
Aus	269	12.30%	87.70%	0.00%	0.00%	NA
Indica I	595	96.10%	3.90%	0.00%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	93.40%	6.50%	0.11%	0.00%	NA
Indica Intermediate	786	91.10%	8.50%	0.38%	0.00%	NA
Temperate Japonica	767	0.40%	99.60%	0.00%	0.00%	NA
Tropical Japonica	504	21.60%	78.40%	0.00%	0.00%	NA
Japonica Intermediate	241	3.70%	96.30%	0.00%	0.00%	NA
VI/Aromatic	96	74.00%	25.00%	1.04%	0.00%	NA
Intermediate	90	45.60%	53.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128797210	C -> T	LOC_Os01g50110.1	missense_variant ; p.Ala184Val; MODERATE	nonsynonymous_codon ; A184V	Average:76.268; most accessible tissue: Minghui63 young leaf, score: 81.195	unknown	unknown	TOLERATED	0.58

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128797210	NA	8.58E-07	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	1.82E-43	mr1089	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	6.60E-35	mr1104	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	1.25E-47	mr1125	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	1.04E-35	mr1129	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	2.59E-17	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	2.05E-30	mr1208	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	9.76E-32	mr1213	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	6.12E-31	mr1225	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	4.52E-12	mr1233	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	2.48E-25	mr1251	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	3.74E-18	mr1253	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	5.98E-32	mr1257	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	8.34E-09	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	9.42E-25	mr1411	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	1.29E-35	mr1745	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	2.94E-06	mr1748	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	3.47E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	8.46E-07	mr1805	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	1.77E-19	mr1807	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	8.84E-36	mr1129_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	1.64E-11	mr1228_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	7.50E-21	mr1253_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	1.88E-24	mr1401_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	1.17E-07	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	1.18E-42	mr1745_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128797210	NA	1.06E-15	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251