Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0128084573:

Variant ID: vg0128084573 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 28084573
Reference Allele: C	Alternative Allele: A
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, A: 0.25, T: 0.02, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:

TATGAAAAGCATGCTAATAAAAAGCGGTAAAATCTGTATATCAGAAAAGAACGGGTCTTTATCTAATTGTGATTTGTCGTTTCAGTCAATTTTCACTTTC[C/A]
GGTGACTTGTACGAGACCGCTGTGCGGTCGCAACTCGCAAGACTATCCAGAACTTTGTACCGAGACCAAACAAGTGGAATGGAAAATCCTGCAGCACCAC

Reverse complement sequence

GTGGTGCTGCAGGATTTTCCATTCCACTTGTTTGGTCTCGGTACAAAGTTCTGGATAGTCTTGCGAGTTGCGACCGCACAGCGGTCTCGTACAAGTCACC[G/T]
GAAAGTGAAAATTGACTGAAACGACAAATCACAATTAGATAAAGACCCGTTCTTTTCTGATATACAGATTTTACCGCTTTTTATTAGCATGCTTTTCATA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	70.00%	29.90%	0.04%	0.00%	NA
All Indica	2759	99.10%	0.90%	0.00%	0.00%	NA
All Japonica	1512	11.70%	88.20%	0.07%	0.00%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	96.80%	3.20%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	98.70%	1.30%	0.00%	0.00%	NA
Temperate Japonica	767	0.50%	99.50%	0.00%	0.00%	NA
Tropical Japonica	504	31.50%	68.30%	0.20%	0.00%	NA
Japonica Intermediate	241	5.80%	94.20%	0.00%	0.00%	NA
VI/Aromatic	96	91.70%	8.30%	0.00%	0.00%	NA
Intermediate	90	57.80%	41.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0128084573	C -> A	LOC_Os01g48930.1	downstream_gene_variant ; 1185.0bp to feature; MODIFIER	silent_mutation	Average:89.62; most accessible tissue: Zhenshan97 young leaf, score: 98.642	N	N	N	N
vg0128084573	C -> A	LOC_Os01g48950.1	downstream_gene_variant ; 3826.0bp to feature; MODIFIER	silent_mutation	Average:89.62; most accessible tissue: Zhenshan97 young leaf, score: 98.642	N	N	N	N
vg0128084573	C -> A	LOC_Os01g48930.2	downstream_gene_variant ; 1185.0bp to feature; MODIFIER	silent_mutation	Average:89.62; most accessible tissue: Zhenshan97 young leaf, score: 98.642	N	N	N	N
vg0128084573	C -> A	LOC_Os01g48940.1	intron_variant ; MODIFIER	silent_mutation	Average:89.62; most accessible tissue: Zhenshan97 young leaf, score: 98.642	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0128084573	C	A	0.02	0.02	-0.01	0.0	0.03	0.05

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0128084573	NA	7.57E-10	mr1175	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128084573	NA	6.00E-15	mr1276	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128084573	NA	8.63E-36	mr1350	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128084573	NA	8.57E-07	mr1532	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128084573	7.49E-08	NA	mr1871	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128084573	NA	1.62E-08	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128084573	NA	2.25E-39	mr1243_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128084573	NA	6.36E-15	mr1277_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128084573	NA	9.24E-24	mr1350_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128084573	NA	1.82E-29	mr1423_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128084573	NA	5.55E-58	mr1599_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128084573	NA	1.08E-57	mr1695_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128084573	NA	1.62E-16	mr1730_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0128084573	NA	4.88E-53	mr1991_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251