\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0127316647:

Variant ID: vg0127316647 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 27316647
Reference Allele: CAlternative Allele: G,T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


AGCGATATAGGGTGATGCCACTCTCATGCATGCTCTGACGCTGGTGATTTTCCACCCGTCCTTCTTTTGTGCTTGGTCTCTGAGACTCAAAGGCTGTGTT[C/G,T]
AGCTGCTTCCAAAATTGAAAGTTTGGGTTAAAATTGGTACGATGTGACTGAAAAGTTGTGTGTGCATGACATATTGATGTGATAGAAAAAAAAGAAAATT

Reverse complement sequence

AATTTTCTTTTTTTTCTATCACATCAATATGTCATGCACACACAACTTTTCAGTCACATCGTACCAATTTTAACCCAAACTTTCAATTTTGGAAGCAGCT[G/C,A]
AACACAGCCTTTGAGTCTCAGAGACCAAGCACAAAAGAAGGACGGGTGGAAAATCACCAGCGTCAGAGCATGCATGAGAGTGGCATCACCCTATATCGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 99.70% 0.10% 0.13% 0.00% G: 0.02%
All Indica  2759 99.60% 0.20% 0.18% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.20% 0.34% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.70% 0.10% 0.22% 0.00% NA
Indica Intermediate  786 99.40% 0.50% 0.13% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 1.11% 0.00% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0127316647 C -> G LOC_Os01g47740.1 upstream_gene_variant ; 4339.0bp to feature; MODIFIER N Average:83.109; most accessible tissue: Zhenshan97 panicle, score: 94.112 N N N N
vg0127316647 C -> G LOC_Os01g47740.4 upstream_gene_variant ; 4342.0bp to feature; MODIFIER N Average:83.109; most accessible tissue: Zhenshan97 panicle, score: 94.112 N N N N
vg0127316647 C -> G LOC_Os01g47740.3 upstream_gene_variant ; 4339.0bp to feature; MODIFIER N Average:83.109; most accessible tissue: Zhenshan97 panicle, score: 94.112 N N N N
vg0127316647 C -> G LOC_Os01g47745.1 downstream_gene_variant ; 2214.0bp to feature; MODIFIER N Average:83.109; most accessible tissue: Zhenshan97 panicle, score: 94.112 N N N N
vg0127316647 C -> G LOC_Os01g47750.1 downstream_gene_variant ; 909.0bp to feature; MODIFIER N Average:83.109; most accessible tissue: Zhenshan97 panicle, score: 94.112 N N N N
vg0127316647 C -> G LOC_Os01g47745-LOC_Os01g47750 intergenic_region ; MODIFIER N Average:83.109; most accessible tissue: Zhenshan97 panicle, score: 94.112 N N N N
vg0127316647 C -> T LOC_Os01g47740.1 upstream_gene_variant ; 4339.0bp to feature; MODIFIER N Average:83.109; most accessible tissue: Zhenshan97 panicle, score: 94.112 N N N N
vg0127316647 C -> T LOC_Os01g47740.4 upstream_gene_variant ; 4342.0bp to feature; MODIFIER N Average:83.109; most accessible tissue: Zhenshan97 panicle, score: 94.112 N N N N
vg0127316647 C -> T LOC_Os01g47740.3 upstream_gene_variant ; 4339.0bp to feature; MODIFIER N Average:83.109; most accessible tissue: Zhenshan97 panicle, score: 94.112 N N N N
vg0127316647 C -> T LOC_Os01g47745.1 downstream_gene_variant ; 2214.0bp to feature; MODIFIER N Average:83.109; most accessible tissue: Zhenshan97 panicle, score: 94.112 N N N N
vg0127316647 C -> T LOC_Os01g47750.1 downstream_gene_variant ; 909.0bp to feature; MODIFIER N Average:83.109; most accessible tissue: Zhenshan97 panicle, score: 94.112 N N N N
vg0127316647 C -> T LOC_Os01g47745-LOC_Os01g47750 intergenic_region ; MODIFIER N Average:83.109; most accessible tissue: Zhenshan97 panicle, score: 94.112 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0127316647 C G -0.03 -0.02 -0.02 -0.01 -0.03 -0.03
vg0127316647 C T -0.03 -0.06 -0.05 -0.03 -0.03 -0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0127316647 NA 1.73E-08 mr1946 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 1.55E-15 mr1040_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 2.32E-07 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 7.14E-18 mr1131_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 3.20E-06 NA mr1168_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 1.17E-17 mr1199_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 1.80E-23 mr1316_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 1.23E-15 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 3.19E-12 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 8.90E-14 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 7.46E-07 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 2.96E-06 NA mr1445_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 1.38E-08 mr1449_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 3.77E-13 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 6.59E-06 mr1524_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 9.21E-23 mr1551_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 1.61E-18 mr1581_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 5.01E-06 NA mr1606_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 1.20E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 1.05E-18 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 9.50E-06 NA mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 6.36E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 6.55E-07 mr1691_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 7.47E-14 mr1713_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 5.82E-06 NA mr1719_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 1.24E-14 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 3.25E-06 NA mr1735_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 1.65E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 7.14E-09 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 6.28E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 4.07E-06 2.84E-10 mr1804_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 3.88E-08 mr1819_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 1.42E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 8.47E-06 mr1852_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 1.71E-34 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 2.90E-06 NA mr1909_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 1.31E-06 mr1915_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 1.34E-24 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 1.50E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 3.00E-16 mr1938_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 4.72E-09 mr1947_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0127316647 NA 6.19E-07 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251