RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0122975265:

Variant ID: vg0122975265 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 22975265
Reference Allele: C	Alternative Allele: G
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, G: 0.25, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

TATTTTAGATAACTTTTAATTCTGAGAAAAATTATAACTACCAGAAAACCTGCTAAAACACATGTAGTAATGAGGAGGGGGAGTACGAGTACTCCATGCT[C/G]
TGCTCCGACATCGCGAAATCAGCTTGCCCCCTCGTCCCCTCTGCCTTTCTTTCTCTCTCTCTCTTTTCTTTCTCTTTTCGGTGAATTGACTGATGTACTG

Reverse complement sequence

CAGTACATCAGTCAATTCACCGAAAAGAGAAAGAAAAGAGAGAGAGAGAAAGAAAGGCAGAGGGGACGAGGGGGCAAGCTGATTTCGCGATGTCGGAGCA[G/C]
AGCATGGAGTACTCGTACTCCCCCTCCTCATTACTACATGTGTTTTAGCAGGTTTTCTGGTAGTTATAATTTTTCTCAGAATTAAAAGTTATCTAAAATA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	73.00%	27.00%	0.06%	0.00%	NA
All Indica	2759	94.20%	5.80%	0.07%	0.00%	NA
All Japonica	1512	44.40%	55.60%	0.00%	0.00%	NA
Aus	269	6.30%	93.70%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	95.50%	4.50%	0.00%	0.00%	NA
Indica III	913	93.00%	7.00%	0.00%	0.00%	NA
Indica Intermediate	786	90.50%	9.30%	0.25%	0.00%	NA
Temperate Japonica	767	4.40%	95.60%	0.00%	0.00%	NA
Tropical Japonica	504	96.40%	3.60%	0.00%	0.00%	NA
Japonica Intermediate	241	62.70%	37.30%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	73.30%	25.60%	1.11%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0122975265	C -> G	LOC_Os01g40640.1	downstream_gene_variant ; 4677.0bp to feature; MODIFIER	silent_mutation	Average:93.607; most accessible tissue: Minghui63 flower, score: 97.341	N	N	N	N
vg0122975265	C -> G	LOC_Os01g40640.4	downstream_gene_variant ; 4677.0bp to feature; MODIFIER	silent_mutation	Average:93.607; most accessible tissue: Minghui63 flower, score: 97.341	N	N	N	N
vg0122975265	C -> G	LOC_Os01g40640.3	downstream_gene_variant ; 4677.0bp to feature; MODIFIER	silent_mutation	Average:93.607; most accessible tissue: Minghui63 flower, score: 97.341	N	N	N	N
vg0122975265	C -> G	LOC_Os01g40630-LOC_Os01g40640	intergenic_region ; MODIFIER	silent_mutation	Average:93.607; most accessible tissue: Minghui63 flower, score: 97.341	N	N	N	N

Showing 1 to 4 of 4 entries

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Show entries

Search:

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0122975265	C	G	0.04	0.07	0.09	0.09	0.1	0.07

Showing 1 to 1 of 1 entries

Previous1Next

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0122975265	NA	3.23E-15	Grain_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0122975265	NA	3.45E-16	mr1013	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122975265	NA	9.21E-08	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122975265	NA	5.49E-14	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122975265	NA	8.28E-12	mr1045	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122975265	NA	1.76E-08	mr1053	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122975265	NA	4.89E-14	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122975265	NA	7.69E-06	mr1094	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122975265	NA	2.50E-18	mr1147	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0122975265	NA	2.08E-09	mr1157	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 72 entries

Previous1 2 3 4 5…8Next

Search for Variation information by Variation ID:

Detailed information for vg0122975265:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Effects Predicted by Deep Convolutional Neural Networks

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact