\
| Variant ID: vg0114325124 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 14325124 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.59, G: 0.41, others allele: 0.00, population size: 85. )
TAGATGTTGCTATTTTTTTAAAACTTATTCAAACATAAAAAGGTGATCGGAGTATATACAAAAGAAATAAATACAAAAGAAATAAAACTTCACAAAATTA[G/A]
CTAAACAAAAAGCAATTTGCCGGTGGGCTATCCTTACAAACAAGCTGGACCTTTTATTTCGGAGTCCAGATGAGTTAAATGAGAGGGTAACAATCAACGC
GCGTTGATTGTTACCCTCTCATTTAACTCATCTGGACTCCGAAATAAAAGGTCCAGCTTGTTTGTAAGGATAGCCCACCGGCAAATTGCTTTTTGTTTAG[C/T]
TAATTTTGTGAAGTTTTATTTCTTTTGTATTTATTTCTTTTGTATATACTCCGATCACCTTTTTATGTTTGAATAAGTTTTAAAAAAATAGCAACATCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.10% | 18.00% | 4.72% | 43.10% | NA |
| All Indica | 2759 | 1.50% | 28.40% | 6.05% | 64.08% | NA |
| All Japonica | 1512 | 97.20% | 2.60% | 0.00% | 0.20% | NA |
| Aus | 269 | 2.60% | 2.60% | 11.52% | 83.27% | NA |
| Indica I | 595 | 1.00% | 12.40% | 6.22% | 80.34% | NA |
| Indica II | 465 | 3.20% | 45.80% | 3.44% | 47.53% | NA |
| Indica III | 913 | 0.80% | 29.60% | 9.53% | 60.13% | NA |
| Indica Intermediate | 786 | 1.70% | 28.80% | 3.44% | 66.16% | NA |
| Temperate Japonica | 767 | 98.40% | 1.40% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 94.80% | 5.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 98.30% | 1.20% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 53.10% | 7.30% | 22.92% | 16.67% | NA |
| Intermediate | 90 | 48.90% | 18.90% | 3.33% | 28.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0114325124 | G -> A | LOC_Os01g25360.1 | upstream_gene_variant ; 1062.0bp to feature; MODIFIER | silent_mutation | Average:38.512; most accessible tissue: Callus, score: 54.917 | N | N | N | N |
| vg0114325124 | G -> A | LOC_Os01g25370.1 | downstream_gene_variant ; 3498.0bp to feature; MODIFIER | silent_mutation | Average:38.512; most accessible tissue: Callus, score: 54.917 | N | N | N | N |
| vg0114325124 | G -> A | LOC_Os01g25370.2 | downstream_gene_variant ; 3498.0bp to feature; MODIFIER | silent_mutation | Average:38.512; most accessible tissue: Callus, score: 54.917 | N | N | N | N |
| vg0114325124 | G -> A | LOC_Os01g25370.3 | downstream_gene_variant ; 4916.0bp to feature; MODIFIER | silent_mutation | Average:38.512; most accessible tissue: Callus, score: 54.917 | N | N | N | N |
| vg0114325124 | G -> A | LOC_Os01g25340-LOC_Os01g25360 | intergenic_region ; MODIFIER | silent_mutation | Average:38.512; most accessible tissue: Callus, score: 54.917 | N | N | N | N |
| vg0114325124 | G -> DEL | N | N | silent_mutation | Average:38.512; most accessible tissue: Callus, score: 54.917 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0114325124 | NA | 3.13E-47 | mr1519 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114325124 | NA | 1.65E-10 | mr1581 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114325124 | NA | 1.62E-08 | mr1739 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114325124 | NA | 1.16E-07 | mr1748 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114325124 | NA | 1.59E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114325124 | NA | 2.84E-07 | mr1604_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114325124 | NA | 5.70E-12 | mr1636_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114325124 | NA | 1.36E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0114325124 | NA | 6.87E-14 | mr1838_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |