\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).


Sorry, variation is wrong, please check.

Detailed information for vg0114325124:

Variant ID: vg0114325124 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14325124
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.59, G: 0.41, others allele: 0.00, population size: 85. )

Flanking Sequence (100 bp) in Reference Genome:


TAGATGTTGCTATTTTTTTAAAACTTATTCAAACATAAAAAGGTGATCGGAGTATATACAAAAGAAATAAATACAAAAGAAATAAAACTTCACAAAATTA[G/A]
CTAAACAAAAAGCAATTTGCCGGTGGGCTATCCTTACAAACAAGCTGGACCTTTTATTTCGGAGTCCAGATGAGTTAAATGAGAGGGTAACAATCAACGC

Reverse complement sequence

GCGTTGATTGTTACCCTCTCATTTAACTCATCTGGACTCCGAAATAAAAGGTCCAGCTTGTTTGTAAGGATAGCCCACCGGCAAATTGCTTTTTGTTTAG[C/T]
TAATTTTGTGAAGTTTTATTTCTTTTGTATTTATTTCTTTTGTATATACTCCGATCACCTTTTTATGTTTGAATAAGTTTTAAAAAAATAGCAACATCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.10% 18.00% 4.72% 43.10% NA
All Indica  2759 1.50% 28.40% 6.05% 64.08% NA
All Japonica  1512 97.20% 2.60% 0.00% 0.20% NA
Aus  269 2.60% 2.60% 11.52% 83.27% NA
Indica I  595 1.00% 12.40% 6.22% 80.34% NA
Indica II  465 3.20% 45.80% 3.44% 47.53% NA
Indica III  913 0.80% 29.60% 9.53% 60.13% NA
Indica Intermediate  786 1.70% 28.80% 3.44% 66.16% NA
Temperate Japonica  767 98.40% 1.40% 0.00% 0.13% NA
Tropical Japonica  504 94.80% 5.00% 0.00% 0.20% NA
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.41% NA
VI/Aromatic  96 53.10% 7.30% 22.92% 16.67% NA
Intermediate  90 48.90% 18.90% 3.33% 28.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114325124 G -> A LOC_Os01g25360.1 upstream_gene_variant ; 1062.0bp to feature; MODIFIER silent_mutation Average:38.512; most accessible tissue: Callus, score: 54.917 N N N N
vg0114325124 G -> A LOC_Os01g25370.1 downstream_gene_variant ; 3498.0bp to feature; MODIFIER silent_mutation Average:38.512; most accessible tissue: Callus, score: 54.917 N N N N
vg0114325124 G -> A LOC_Os01g25370.2 downstream_gene_variant ; 3498.0bp to feature; MODIFIER silent_mutation Average:38.512; most accessible tissue: Callus, score: 54.917 N N N N
vg0114325124 G -> A LOC_Os01g25370.3 downstream_gene_variant ; 4916.0bp to feature; MODIFIER silent_mutation Average:38.512; most accessible tissue: Callus, score: 54.917 N N N N
vg0114325124 G -> A LOC_Os01g25340-LOC_Os01g25360 intergenic_region ; MODIFIER silent_mutation Average:38.512; most accessible tissue: Callus, score: 54.917 N N N N
vg0114325124 G -> DEL N N silent_mutation Average:38.512; most accessible tissue: Callus, score: 54.917 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114325124 NA 3.13E-47 mr1519 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114325124 NA 1.65E-10 mr1581 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114325124 NA 1.62E-08 mr1739 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114325124 NA 1.16E-07 mr1748 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114325124 NA 1.59E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114325124 NA 2.84E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114325124 NA 5.70E-12 mr1636_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114325124 NA 1.36E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114325124 NA 6.87E-14 mr1838_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251