\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114152375:

Variant ID: vg0114152375 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 14152375
Reference Allele: TAlternative Allele: C,G
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.28, G: 0.02, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:


GTGGCCGACAAACGGACTCCACTGGACACCACGCGGGCTACACATGTGAAACCACGCGGCTACCGAGCGGGCACACAAACATGGTCACCACACACACAAG[T/C,G]
GAACGACTACCGACACCGGTACACGGGTACCGGGGTCGACCACCGCACAATAGGGATGGGGCGACACCGAAAGGACGAGGACGGGGGCAGCGAAGGAGAG

Reverse complement sequence

CTCTCCTTCGCTGCCCCCGTCCTCGTCCTTTCGGTGTCGCCCCATCCCTATTGTGCGGTGGTCGACCCCGGTACCCGTGTACCGGTGTCGGTAGTCGTTC[A/G,C]
CTTGTGTGTGTGGTGACCATGTTTGTGTGCCCGCTCGGTAGCCGCGTGGTTTCACATGTGTAGCCCGCGTGGTGTCCAGTGGAGTCCGTTTGTCGGCCAC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.40% 33.60% 1.10% 17.84% G: 0.06%
All Indica  2759 72.20% 2.00% 1.09% 24.65% G: 0.11%
All Japonica  1512 4.80% 95.20% 0.00% 0.00% NA
Aus  269 38.70% 0.70% 5.95% 54.65% NA
Indica I  595 94.30% 0.80% 0.67% 4.20% NA
Indica II  465 51.20% 5.40% 0.65% 42.37% G: 0.43%
Indica III  913 71.90% 0.40% 1.10% 26.62% NA
Indica Intermediate  786 68.30% 2.50% 1.65% 27.35% G: 0.13%
Temperate Japonica  767 2.00% 98.00% 0.00% 0.00% NA
Tropical Japonica  504 10.50% 89.50% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 46.90% 51.00% 0.00% 2.08% NA
Intermediate  90 31.10% 46.70% 6.67% 15.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0114152375 T -> G LOC_Os01g25080.1 upstream_gene_variant ; 598.0bp to feature; MODIFIER silent_mutation Average:30.99; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N
vg0114152375 T -> G LOC_Os01g25070.1 downstream_gene_variant ; 2108.0bp to feature; MODIFIER silent_mutation Average:30.99; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N
vg0114152375 T -> G LOC_Os01g25070-LOC_Os01g25080 intergenic_region ; MODIFIER silent_mutation Average:30.99; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N
vg0114152375 T -> DEL N N silent_mutation Average:30.99; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N
vg0114152375 T -> C LOC_Os01g25080.1 upstream_gene_variant ; 598.0bp to feature; MODIFIER silent_mutation Average:30.99; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N
vg0114152375 T -> C LOC_Os01g25070.1 downstream_gene_variant ; 2108.0bp to feature; MODIFIER silent_mutation Average:30.99; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N
vg0114152375 T -> C LOC_Os01g25070-LOC_Os01g25080 intergenic_region ; MODIFIER silent_mutation Average:30.99; most accessible tissue: Zhenshan97 flag leaf, score: 67.785 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0114152375 NA 5.80E-20 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 5.20E-25 mr1903 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 5.45E-10 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 4.46E-15 mr1162_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 9.79E-06 mr1332_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 1.41E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 6.59E-11 mr1349_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 4.04E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 6.32E-34 mr1448_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 7.27E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 2.47E-46 mr1546_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 4.57E-08 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 5.22E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 4.92E-19 mr1712_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 2.42E-14 mr1717_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 1.81E-12 mr1722_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 4.22E-07 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 9.72E-08 mr1749_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 1.63E-16 mr1836_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 1.35E-14 mr1893_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 4.88E-09 mr1946_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375 NA 4.88E-09 mr1948_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251