Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0114152375:

Variant ID: vg0114152375 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 14152375
Reference Allele: T	Alternative Allele: C,G
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, C: 0.28, G: 0.02, others allele: 0.00, population size: 50. )

Flanking Sequence (100 bp) in Reference Genome:

GTGGCCGACAAACGGACTCCACTGGACACCACGCGGGCTACACATGTGAAACCACGCGGCTACCGAGCGGGCACACAAACATGGTCACCACACACACAAG[T/C,G]
GAACGACTACCGACACCGGTACACGGGTACCGGGGTCGACCACCGCACAATAGGGATGGGGCGACACCGAAAGGACGAGGACGGGGGCAGCGAAGGAGAG

Reverse complement sequence

CTCTCCTTCGCTGCCCCCGTCCTCGTCCTTTCGGTGTCGCCCCATCCCTATTGTGCGGTGGTCGACCCCGGTACCCGTGTACCGGTGTCGGTAGTCGTTC[A/G,C]
CTTGTGTGTGTGGTGACCATGTTTGTGTGCCCGCTCGGTAGCCGCGTGGTTTCACATGTGTAGCCCGCGTGGTGTCCAGTGGAGTCCGTTTGTCGGCCAC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.40%	33.60%	1.10%	17.84%	G: 0.06%
All Indica	2759	72.20%	2.00%	1.09%	24.65%	G: 0.11%
All Japonica	1512	4.80%	95.20%	0.00%	0.00%	NA
Aus	269	38.70%	0.70%	5.95%	54.65%	NA
Indica I	595	94.30%	0.80%	0.67%	4.20%	NA
Indica II	465	51.20%	5.40%	0.65%	42.37%	G: 0.43%
Indica III	913	71.90%	0.40%	1.10%	26.62%	NA
Indica Intermediate	786	68.30%	2.50%	1.65%	27.35%	G: 0.13%
Temperate Japonica	767	2.00%	98.00%	0.00%	0.00%	NA
Tropical Japonica	504	10.50%	89.50%	0.00%	0.00%	NA
Japonica Intermediate	241	2.10%	97.90%	0.00%	0.00%	NA
VI/Aromatic	96	46.90%	51.00%	0.00%	2.08%	NA
Intermediate	90	31.10%	46.70%	6.67%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0114152375	T -> G	LOC_Os01g25080.1	upstream_gene_variant ; 598.0bp to feature; MODIFIER	silent_mutation	Average:30.99; most accessible tissue: Zhenshan97 flag leaf, score: 67.785	N	N	N	N
vg0114152375	T -> G	LOC_Os01g25070.1	downstream_gene_variant ; 2108.0bp to feature; MODIFIER	silent_mutation	Average:30.99; most accessible tissue: Zhenshan97 flag leaf, score: 67.785	N	N	N	N
vg0114152375	T -> G	LOC_Os01g25070-LOC_Os01g25080	intergenic_region ; MODIFIER	silent_mutation	Average:30.99; most accessible tissue: Zhenshan97 flag leaf, score: 67.785	N	N	N	N
vg0114152375	T -> DEL	N	N	silent_mutation	Average:30.99; most accessible tissue: Zhenshan97 flag leaf, score: 67.785	N	N	N	N
vg0114152375	T -> C	LOC_Os01g25080.1	upstream_gene_variant ; 598.0bp to feature; MODIFIER	silent_mutation	Average:30.99; most accessible tissue: Zhenshan97 flag leaf, score: 67.785	N	N	N	N
vg0114152375	T -> C	LOC_Os01g25070.1	downstream_gene_variant ; 2108.0bp to feature; MODIFIER	silent_mutation	Average:30.99; most accessible tissue: Zhenshan97 flag leaf, score: 67.785	N	N	N	N
vg0114152375	T -> C	LOC_Os01g25070-LOC_Os01g25080	intergenic_region ; MODIFIER	silent_mutation	Average:30.99; most accessible tissue: Zhenshan97 flag leaf, score: 67.785	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0114152375	NA	5.80E-20	mr1102	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	5.20E-25	mr1903	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	5.45E-10	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	4.46E-15	mr1162_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	9.79E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	1.41E-06	mr1332_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	6.59E-11	mr1349_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	4.04E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	6.32E-34	mr1448_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	7.27E-06	mr1462_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	2.47E-46	mr1546_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	4.57E-08	mr1576_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	5.22E-07	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	4.92E-19	mr1712_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	2.42E-14	mr1717_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	1.81E-12	mr1722_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	4.22E-07	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	9.72E-08	mr1749_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	1.63E-16	mr1836_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	1.35E-14	mr1893_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	4.88E-09	mr1946_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0114152375	NA	4.88E-09	mr1948_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251