Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0113993155:

Variant ID: vg0113993155 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13993155
Reference Allele: CAlternative Allele: G,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, C: 0.01, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


AAGCGCTTCGATGGACCGATAGGCGAGCACCAATGGCCCTATGGGTCAGTCTGTTGGGATTAGAAAAAAAATACTCGTATCAGACATGGCTTGATGTACC[C/G,A]
AAAAAAGGAAGCCTTTAATCCCTATAAACTTAGTTAAACTGAAAAGGTTCGAATAAAAGAAGTCTAAGCGACTTATAATACAAAACGGAGGGAGTACAAT

Reverse complement sequence

ATTGTACTCCCTCCGTTTTGTATTATAAGTCGCTTAGACTTCTTTTATTCGAACCTTTTCAGTTTAACTAAGTTTATAGGGATTAAAGGCTTCCTTTTTT[G/C,T]
GGTACATCAAGCCATGTCTGATACGAGTATTTTTTTTCTAATCCCAACAGACTGACCCATAGGGCCATTGGTGCTCGCCTATCGGTCCATCGAAGCGCTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.90% 40.00% 0.04% 0.00% A: 0.02%
All Indica  2759 87.00% 12.90% 0.07% 0.00% NA
All Japonica  1512 5.00% 95.00% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 99.30% 0.50% 0.17% 0.00% NA
Indica II  465 84.70% 15.30% 0.00% 0.00% NA
Indica III  913 76.80% 23.20% 0.00% 0.00% NA
Indica Intermediate  786 90.80% 9.00% 0.13% 0.00% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 11.10% 88.90% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 47.90% 51.00% 0.00% 0.00% A: 1.04%
Intermediate  90 48.90% 51.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113993155 C -> G LOC_Os01g24840.1 upstream_gene_variant ; 4444.0bp to feature; MODIFIER silent_mutation Average:82.626; most accessible tissue: Zhenshan97 flower, score: 91.879 N N N N
vg0113993155 C -> G LOC_Os01g24840-LOC_Os01g24860 intergenic_region ; MODIFIER silent_mutation Average:82.626; most accessible tissue: Zhenshan97 flower, score: 91.879 N N N N
vg0113993155 C -> A LOC_Os01g24840.1 upstream_gene_variant ; 4444.0bp to feature; MODIFIER silent_mutation Average:82.626; most accessible tissue: Zhenshan97 flower, score: 91.879 N N N N
vg0113993155 C -> A LOC_Os01g24840-LOC_Os01g24860 intergenic_region ; MODIFIER silent_mutation Average:82.626; most accessible tissue: Zhenshan97 flower, score: 91.879 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0113993155 C A 0.05 0.05 0.05 0.05 0.06 0.05
vg0113993155 C G 0.03 0.05 0.05 0.05 0.04 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113993155 NA 1.28E-19 mr1102 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113993155 NA 2.99E-45 mr1141 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113993155 NA 1.23E-60 mr1141_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113993155 NA 6.88E-11 mr1216_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113993155 NA 1.74E-14 mr1277_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113993155 NA 3.55E-24 mr1403_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113993155 NA 4.64E-07 mr1408_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113993155 NA 8.66E-19 mr1416_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113993155 NA 3.06E-44 mr1519_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113993155 NA 7.03E-19 mr1637_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113993155 NA 1.16E-09 mr1705_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113993155 NA 1.18E-22 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251