Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0113990076:

Variant ID: vg0113990076 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 13990076
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGAGTGATTATACCTTAGAGCAGGTACAATAGCAGGCTATAAGCCAGTTATAAATATATTTTAAAGAGATAAAGGAAGAGAGAGAAGAGCAGCAGGCTA[T/C]
AGATCTGTAGCCGCTGTAACACGGACTCCAAGACGTAATGTGTGTATGACAGGTGGGACCAAATATTAATAGTATAGTAAGCTACTATTATATGAGTTGG

Reverse complement sequence

CCAACTCATATAATAGTAGCTTACTATACTATTAATATTTGGTCCCACCTGTCATACACACATTACGTCTTGGAGTCCGTGTTACAGCGGCTACAGATCT[A/G]
TAGCCTGCTGCTCTTCTCTCTCTTCCTTTATCTCTTTAAAATATATTTATAACTGGCTTATAGCCTGCTATTGTACCTGCTCTAAGGTATAATCACTCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele)Frequency of T(secondary allele)Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.30% 9.90% 3.79% 0.00% NA
All Indica  2759 99.50% 0.30% 0.14% 0.00% NA
All Japonica  1512 58.70% 30.00% 11.31% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.30% 0.38% 0.00% NA
Temperate Japonica  767 28.90% 55.70% 15.38% 0.00% NA
Tropical Japonica  504 94.40% 0.60% 4.96% 0.00% NA
Japonica Intermediate  241 78.80% 9.50% 11.62% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 5.60% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0113990076 T -> C LOC_Os01g24840.1 upstream_gene_variant ; 1365.0bp to feature; MODIFIER silent_mutation Average:52.086; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0113990076 T -> C LOC_Os01g24830.1 downstream_gene_variant ; 4396.0bp to feature; MODIFIER silent_mutation Average:52.086; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N
vg0113990076 T -> C LOC_Os01g24840-LOC_Os01g24860 intergenic_region ; MODIFIER silent_mutation Average:52.086; most accessible tissue: Minghui63 panicle, score: 64.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0113990076 NA 6.76E-06 mr1075 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 2.91E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 5.76E-06 mr1177 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 3.31E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 4.66E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 4.27E-08 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 5.47E-08 mr1205 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 4.27E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 3.66E-06 mr1280 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 3.31E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 7.11E-08 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 2.61E-06 mr1359 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 5.07E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 3.32E-08 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 4.77E-07 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 2.09E-06 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 1.21E-07 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 1.24E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 3.06E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 7.48E-06 NA mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 1.53E-10 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 1.52E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 3.32E-07 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 1.64E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 2.00E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 1.49E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 2.23E-07 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0113990076 NA 2.25E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251