Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112046165:

Variant ID: vg0112046165 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 12046165
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.14, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:

CTGATGTATCCTTTCTGAAGCAAATCATCTACTTGCCTCTTGACTTCTGCTAATTCATTGGCCGCCATTCTATAAGGTCTCTTATGGATCGGAGTTGTTC[T/C]
TGGTACCAGATCTATTCTGAATTCAATATCTCTTTTAGGCGGCATACCAGGTAAATCGTCCGGGAACACGTCCGGGTATTCCTGTACTATGGGAATCTCT

Reverse complement sequence

AGAGATTCCCATAGTACAGGAATACCCGGACGTGTTCCCGGACGATTTACCTGGTATGCCGCCTAAAAGAGATATTGAATTCAGAATAGATCTGGTACCA[A/G]
GAACAACTCCGATCCATAAGAGACCTTATAGAATGGCGGCCAATGAATTAGCAGAAGTCAAGAGGCAAGTAGATGATTTGCTTCAGAAAGGATACATCAG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	24.50%	11.90%	29.05%	34.62%	NA
All Indica	2759	2.20%	6.90%	38.31%	52.52%	NA
All Japonica	1512	69.30%	23.70%	4.37%	2.58%	NA
Aus	269	0.70%	0.00%	69.14%	30.11%	NA
Indica I	595	2.20%	1.20%	47.06%	49.58%	NA
Indica II	465	2.60%	2.40%	32.04%	63.01%	NA
Indica III	913	0.90%	15.80%	34.17%	49.18%	NA
Indica Intermediate	786	3.70%	3.70%	40.20%	52.42%	NA
Temperate Japonica	767	75.90%	20.20%	2.09%	1.83%	NA
Tropical Japonica	504	52.60%	34.50%	8.53%	4.37%	NA
Japonica Intermediate	241	83.40%	12.40%	2.90%	1.24%	NA
VI/Aromatic	96	22.90%	1.00%	37.50%	38.54%	NA
Intermediate	90	24.40%	11.10%	31.11%	33.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0112046165	T -> DEL	LOC_Os01g21536.1	N	frameshift_variant	Average:13.383; most accessible tissue: Zhenshan97 panicle, score: 20.424	N	N	N	N
vg0112046165	T -> C	LOC_Os01g21536.1	missense_variant ; p.Arg723Gly; MODERATE	nonsynonymous_codon ; R723G	Average:13.383; most accessible tissue: Zhenshan97 panicle, score: 20.424	benign	-1.041	TOLERATED	1.00

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0112046165	NA	1.77E-13	Plant_height	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0112046165	NA	9.60E-10	mr1028	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165	NA	1.06E-07	mr1245	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165	NA	7.31E-08	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165	NA	5.80E-07	mr1373	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165	NA	8.61E-06	mr1418	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165	NA	1.57E-09	mr1453	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165	NA	3.85E-09	mr1652	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165	NA	5.02E-06	mr1773	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165	NA	2.92E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165	NA	2.92E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165	NA	2.75E-06	mr1802	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165	NA	1.79E-07	mr1010_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165	NA	1.52E-06	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165	4.18E-06	NA	mr1164_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165	NA	3.88E-09	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165	NA	6.74E-09	mr1709_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165	NA	8.04E-06	mr1865_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251