\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0112046165:

Variant ID: vg0112046165 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 12046165
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.86, T: 0.14, others allele: 0.00, population size: 58. )

Flanking Sequence (100 bp) in Reference Genome:


CTGATGTATCCTTTCTGAAGCAAATCATCTACTTGCCTCTTGACTTCTGCTAATTCATTGGCCGCCATTCTATAAGGTCTCTTATGGATCGGAGTTGTTC[T/C]
TGGTACCAGATCTATTCTGAATTCAATATCTCTTTTAGGCGGCATACCAGGTAAATCGTCCGGGAACACGTCCGGGTATTCCTGTACTATGGGAATCTCT

Reverse complement sequence

AGAGATTCCCATAGTACAGGAATACCCGGACGTGTTCCCGGACGATTTACCTGGTATGCCGCCTAAAAGAGATATTGAATTCAGAATAGATCTGGTACCA[A/G]
GAACAACTCCGATCCATAAGAGACCTTATAGAATGGCGGCCAATGAATTAGCAGAAGTCAAGAGGCAAGTAGATGATTTGCTTCAGAAAGGATACATCAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 24.50% 11.90% 29.05% 34.62% NA
All Indica  2759 2.20% 6.90% 38.31% 52.52% NA
All Japonica  1512 69.30% 23.70% 4.37% 2.58% NA
Aus  269 0.70% 0.00% 69.14% 30.11% NA
Indica I  595 2.20% 1.20% 47.06% 49.58% NA
Indica II  465 2.60% 2.40% 32.04% 63.01% NA
Indica III  913 0.90% 15.80% 34.17% 49.18% NA
Indica Intermediate  786 3.70% 3.70% 40.20% 52.42% NA
Temperate Japonica  767 75.90% 20.20% 2.09% 1.83% NA
Tropical Japonica  504 52.60% 34.50% 8.53% 4.37% NA
Japonica Intermediate  241 83.40% 12.40% 2.90% 1.24% NA
VI/Aromatic  96 22.90% 1.00% 37.50% 38.54% NA
Intermediate  90 24.40% 11.10% 31.11% 33.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0112046165 T -> DEL LOC_Os01g21536.1 N frameshift_variant Average:13.383; most accessible tissue: Zhenshan97 panicle, score: 20.424 N N N N
vg0112046165 T -> C LOC_Os01g21536.1 missense_variant ; p.Arg723Gly; MODERATE nonsynonymous_codon ; R723G Average:13.383; most accessible tissue: Zhenshan97 panicle, score: 20.424 benign -1.041 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0112046165 NA 1.77E-13 Plant_height Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0112046165 NA 9.60E-10 mr1028 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165 NA 1.06E-07 mr1245 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165 NA 7.31E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165 NA 5.80E-07 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165 NA 8.61E-06 mr1418 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165 NA 1.57E-09 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165 NA 3.85E-09 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165 NA 5.02E-06 mr1773 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165 NA 2.92E-07 mr1797 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165 NA 2.92E-07 mr1801 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165 NA 2.75E-06 mr1802 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165 NA 1.79E-07 mr1010_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165 NA 1.52E-06 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165 4.18E-06 NA mr1164_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165 NA 3.88E-09 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165 NA 6.74E-09 mr1709_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0112046165 NA 8.04E-06 mr1865_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251