\
| Variant ID: vg0109353965 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 9353965 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.93, A: 0.07, others allele: 0.00, population size: 116. )
AGCCTAAATTGAATTTTTAATTGGCCTCAAGAAAATATCGGTGTAAAAGCAAGAGAGAAACCCTAAATAAATTAATGCGAATAATAATCGGAATTGGCAT[A/G]
TGGAATTTTTCTTGAGTTCTACATGTCGAAATGTGCTAACAAGATTTTTAGTGGAATTTTCAGAGCTCTAGAAATAATTTTAACCAATTAAAATCGAGCA
TGCTCGATTTTAATTGGTTAAAATTATTTCTAGAGCTCTGAAAATTCCACTAAAAATCTTGTTAGCACATTTCGACATGTAGAACTCAAGAAAAATTCCA[T/C]
ATGCCAATTCCGATTATTATTCGCATTAATTTATTTAGGGTTTCTCTCTTGCTTTTACACCGATATTTTCTTGAGGCCAATTAAAAATTCAATTTAGGCT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.00% | 16.80% | 8.55% | 47.67% | NA |
| All Indica | 2759 | 3.10% | 23.70% | 4.82% | 68.43% | NA |
| All Japonica | 1512 | 72.50% | 1.30% | 15.54% | 10.65% | NA |
| Aus | 269 | 0.70% | 41.60% | 3.35% | 54.28% | NA |
| Indica I | 595 | 3.40% | 14.80% | 4.03% | 77.82% | NA |
| Indica II | 465 | 3.00% | 16.60% | 2.58% | 77.85% | NA |
| Indica III | 913 | 2.00% | 35.80% | 7.67% | 54.55% | NA |
| Indica Intermediate | 786 | 4.20% | 20.50% | 3.44% | 71.88% | NA |
| Temperate Japonica | 767 | 67.00% | 0.30% | 15.38% | 17.34% | NA |
| Tropical Japonica | 504 | 82.30% | 3.20% | 11.51% | 2.98% | NA |
| Japonica Intermediate | 241 | 69.30% | 0.80% | 24.48% | 5.39% | NA |
| VI/Aromatic | 96 | 68.80% | 0.00% | 18.75% | 12.50% | NA |
| Intermediate | 90 | 31.10% | 7.80% | 10.00% | 51.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0109353965 | A -> G | LOC_Os01g16470.1 | downstream_gene_variant ; 2629.0bp to feature; MODIFIER | silent_mutation | Average:51.55; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| vg0109353965 | A -> G | LOC_Os01g16480.1 | intron_variant ; MODIFIER | silent_mutation | Average:51.55; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| vg0109353965 | A -> DEL | N | N | silent_mutation | Average:51.55; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0109353965 | 3.18E-06 | NA | mr1301 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109353965 | 1.41E-06 | 1.41E-06 | mr1347 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109353965 | 4.59E-06 | NA | mr1382 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109353965 | NA | 2.24E-06 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109353965 | 4.56E-06 | 3.62E-08 | mr1398 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109353965 | NA | 2.96E-07 | mr1398 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109353965 | 1.63E-09 | NA | mr1422 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109353965 | 5.87E-06 | 3.40E-08 | mr1422 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109353965 | NA | 1.11E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109353965 | NA | 3.50E-06 | mr1602 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109353965 | 8.46E-06 | NA | mr1696 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109353965 | NA | 2.76E-07 | mr1993 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109353965 | NA | 9.39E-08 | mr1084_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109353965 | NA | 2.35E-06 | mr1206_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109353965 | NA | 7.89E-06 | mr1405_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109353965 | NA | 6.36E-06 | mr1419_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0109353965 | NA | 6.15E-08 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |