\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106725146:

Variant ID: vg0106725146 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 6725146
Reference Allele: TAlternative Allele: A,TA,TAAA,TCA
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.77, T: 0.23, others allele: 0.00, population size: 53. )

Flanking Sequence (100 bp) in Reference Genome:


AGGAGTTTTTTCTCCACAATTTTACTCGGATCATCTGCAAGGCTGATGTTCCTTCACGAAGGAAAATCGACCAACAACTAACATTACATGTAGTTCTTTT[T/A,TA,TAAA,TCA]
AAAAAAAAAACTAGCATTACATGTGTGTATCCGACGTTCGTGCCATATCAATTTTAGGAGGTAGCTCTTGCAGATAAGGTTATGGCATGAAGCCAATCAT

Reverse complement sequence

ATGATTGGCTTCATGCCATAACCTTATCTGCAAGAGCTACCTCCTAAAATTGATATGGCACGAACGTCGGATACACACATGTAATGCTAGTTTTTTTTTT[A/T,TA,TTTA,TGA]
AAAAGAACTACATGTAATGTTAGTTGTTGGTCGATTTTCCTTCGTGAAGGAACATCAGCCTTGCAGATGATCCGAGTAAAATTGTGGAGAAAAAACTCCT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.00% 32.60% 0.74% 0.00% TA: 0.68%; TCA: 0.04%
All Indica  2759 73.00% 26.70% 0.29% 0.00% NA
All Japonica  1512 47.20% 49.70% 1.39% 0.00% TA: 1.65%
Aus  269 95.50% 0.00% 1.86% 0.00% TA: 2.60%
Indica I  595 95.10% 4.40% 0.50% 0.00% NA
Indica II  465 52.00% 47.70% 0.22% 0.00% NA
Indica III  913 71.50% 28.40% 0.11% 0.00% NA
Indica Intermediate  786 70.50% 29.10% 0.38% 0.00% NA
Temperate Japonica  767 13.70% 80.80% 2.22% 0.00% TA: 3.26%
Tropical Japonica  504 89.30% 10.10% 0.60% 0.00% NA
Japonica Intermediate  241 66.00% 33.60% 0.41% 0.00% NA
VI/Aromatic  96 84.40% 13.50% 0.00% 0.00% TCA: 2.08%
Intermediate  90 56.70% 42.20% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106725146 T -> TCA LOC_Os01g12320.1 3_prime_UTR_variant ; 53.0bp to feature; MODIFIER silent_mutation Average:79.541; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0106725146 T -> TCA LOC_Os01g12320.3 3_prime_UTR_variant ; 53.0bp to feature; MODIFIER silent_mutation Average:79.541; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0106725146 T -> TCA LOC_Os01g12320.2 3_prime_UTR_variant ; 53.0bp to feature; MODIFIER silent_mutation Average:79.541; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0106725146 T -> TCA LOC_Os01g12310.1 downstream_gene_variant ; 2547.0bp to feature; MODIFIER silent_mutation Average:79.541; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0106725146 T -> TA LOC_Os01g12320.1 3_prime_UTR_variant ; 53.0bp to feature; MODIFIER silent_mutation Average:79.541; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0106725146 T -> TA LOC_Os01g12320.3 3_prime_UTR_variant ; 53.0bp to feature; MODIFIER silent_mutation Average:79.541; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0106725146 T -> TA LOC_Os01g12320.2 3_prime_UTR_variant ; 53.0bp to feature; MODIFIER silent_mutation Average:79.541; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0106725146 T -> TA LOC_Os01g12310.1 downstream_gene_variant ; 2547.0bp to feature; MODIFIER silent_mutation Average:79.541; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0106725146 T -> A LOC_Os01g12320.1 3_prime_UTR_variant ; 54.0bp to feature; MODIFIER silent_mutation Average:79.541; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0106725146 T -> A LOC_Os01g12320.3 3_prime_UTR_variant ; 54.0bp to feature; MODIFIER silent_mutation Average:79.541; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0106725146 T -> A LOC_Os01g12320.2 3_prime_UTR_variant ; 54.0bp to feature; MODIFIER silent_mutation Average:79.541; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0106725146 T -> A LOC_Os01g12310.1 downstream_gene_variant ; 2546.0bp to feature; MODIFIER silent_mutation Average:79.541; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0106725146 T -> TAAA LOC_Os01g12320.1 3_prime_UTR_variant ; 53.0bp to feature; MODIFIER N Average:79.541; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0106725146 T -> TAAA LOC_Os01g12320.3 3_prime_UTR_variant ; 53.0bp to feature; MODIFIER N Average:79.541; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0106725146 T -> TAAA LOC_Os01g12320.2 3_prime_UTR_variant ; 53.0bp to feature; MODIFIER N Average:79.541; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N
vg0106725146 T -> TAAA LOC_Os01g12310.1 downstream_gene_variant ; 2547.0bp to feature; MODIFIER N Average:79.541; most accessible tissue: Zhenshan97 flower, score: 91.701 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0106725146 T A -0.01 -0.04 -0.03 0.0 0.0 0.0
vg0106725146 T TA -0.07 0.11 0.11 -0.03 -0.03 -0.06
vg0106725146 T TAAA 0.07 -0.21 -0.11 -0.07 -0.1 0.04
vg0106725146 T TCA 0.16 0.12 0.11 -0.03 0.02 0.09

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106725146 NA 1.67E-16 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0106725146 6.62E-06 1.82E-08 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106725146 3.55E-06 1.74E-07 mr1639 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106725146 6.24E-09 NA mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106725146 2.87E-08 NA mr1769 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106725146 NA 4.32E-08 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106725146 NA 1.02E-06 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106725146 3.02E-09 1.84E-07 mr1498_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106725146 9.26E-09 NA mr1769_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106725146 7.51E-06 NA mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106725146 NA 3.48E-07 mr1808_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106725146 3.57E-06 9.36E-08 mr1925_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251