\
| Variant ID: vg0106089280 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6089280 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATAAGAGTATAGTTGCAGAGCCGCCGACGATTGATGGGACTTCTAGAAAATAAAAAAAAAATGAATTCCAACGATAGTTATGTTCGATTTTTAGAATCA[C/T]
AGTGACAATAAAGAGTAGGCAGCAGACGGGCTGTAGAGGGGCATAGTGGCATCGTTTGATGGGACTTCTAAAAATTATAAAAAATAAAACTACAAGTCCT
AGGACTTGTAGTTTTATTTTTTATAATTTTTAGAAGTCCCATCAAACGATGCCACTATGCCCCTCTACAGCCCGTCTGCTGCCTACTCTTTATTGTCACT[G/A]
TGATTCTAAAAATCGAACATAACTATCGTTGGAATTCATTTTTTTTTTATTTTCTAGAAGTCCCATCAATCGTCGGCGGCTCTGCAACTATACTCTTATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.40% | 2.30% | 1.02% | 3.26% | NA |
| All Indica | 2759 | 93.70% | 0.10% | 0.76% | 5.44% | NA |
| All Japonica | 1512 | 90.90% | 7.10% | 1.79% | 0.13% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 0.00% | 1.01% | 0.17% | NA |
| Indica II | 465 | 92.90% | 0.00% | 0.65% | 6.45% | NA |
| Indica III | 913 | 89.80% | 0.10% | 0.33% | 9.75% | NA |
| Indica Intermediate | 786 | 94.90% | 0.10% | 1.15% | 3.82% | NA |
| Temperate Japonica | 767 | 82.50% | 14.10% | 3.39% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106089280 | C -> T | LOC_Os01g11340-LOC_Os01g11350 | intergenic_region ; MODIFIER | silent_mutation | Average:22.977; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 | N | N | N | N |
| vg0106089280 | C -> DEL | N | N | silent_mutation | Average:22.977; most accessible tissue: Zhenshan97 flag leaf, score: 49.013 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106089280 | 9.38E-06 | NA | mr1309 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106089280 | 2.85E-07 | 3.80E-06 | mr1238_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106089280 | 8.54E-07 | 8.54E-07 | mr1484_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106089280 | 4.24E-06 | NA | mr1841_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106089280 | 1.51E-06 | NA | mr1900_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106089280 | 1.71E-07 | 1.71E-07 | mr1945_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |