| Variant ID: vg0103668341 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 3668341 |
| Reference Allele: C | Alternative Allele: A |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.01, others allele: 0.00, population size: 286. )
TCAAGAACATTTTTTCAGCTTATCTGTTCTGCTAGGGAAAAGAAGCTCCACTATCTTGCACATCAAATCTTATCAATGCATGTACTCAACAAAAAAAAGG[C/A]
AAAAAAGATCCTGAGAATGACATACAGACTTGTCAAAAAAAAGCTCTATGACGGACGAAACAAAAGGACATATCACAACAAACTGAGTGGACATATAAAG
CTTTATATGTCCACTCAGTTTGTTGTGATATGTCCTTTTGTTTCGTCCGTCATAGAGCTTTTTTTTGACAAGTCTGTATGTCATTCTCAGGATCTTTTTT[G/T]
CCTTTTTTTTGTTGAGTACATGCATTGATAAGATTTGATGTGCAAGATAGTGGAGCTTCTTTTCCCTAGCAGAACAGATAAGCTGAAAAAATGTTCTTGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.90% | 9.90% | 0.17% | 0.06% | NA |
| All Indica | 2759 | 83.60% | 16.00% | 0.29% | 0.11% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 51.10% | 47.90% | 0.67% | 0.34% | NA |
| Indica II | 465 | 97.20% | 2.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.00% | 6.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 88.00% | 11.30% | 0.51% | 0.13% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0103668341 | C -> A | LOC_Os01g07620.1 | upstream_gene_variant ; 2295.0bp to feature; MODIFIER | silent_mutation | Average:47.422; most accessible tissue: Minghui63 flower, score: 72.332 | N | N | N | N |
| vg0103668341 | C -> A | LOC_Os01g07610.1 | downstream_gene_variant ; 4022.0bp to feature; MODIFIER | silent_mutation | Average:47.422; most accessible tissue: Minghui63 flower, score: 72.332 | N | N | N | N |
| vg0103668341 | C -> A | LOC_Os01g07630.1 | intron_variant ; MODIFIER | silent_mutation | Average:47.422; most accessible tissue: Minghui63 flower, score: 72.332 | N | N | N | N |
| vg0103668341 | C -> DEL | N | N | silent_mutation | Average:47.422; most accessible tissue: Minghui63 flower, score: 72.332 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0103668341 | 3.81E-06 | NA | mr1107 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103668341 | NA | 7.63E-06 | mr1676 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103668341 | NA | 4.40E-06 | mr1389_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0103668341 | NA | 3.59E-06 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |