Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103667842:

Variant ID: vg0103667842 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3667842
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


TCGACACCGATCACCTCGGTCCAGAGAGCTCCATGGCTTCCAAGCCAAGGGAGGATTCGTCTGCCGCAAAATCCATGAATTTTGGGGGTAGAAGCTCTGA[C/T]
GAAACGGATTTCGGTGTGTCGACGTTCTGTGATGCCTCCCATTTCTCCGCGAGACCGTCCCCTTCCAGCATTCTGATCACCTCCGACATTCTGGGACGAT

Reverse complement sequence

ATCGTCCCAGAATGTCGGAGGTGATCAGAATGCTGGAAGGGGACGGTCTCGCGGAGAAATGGGAGGCATCACAGAACGTCGACACACCGAAATCCGTTTC[G/A]
TCAGAGCTTCTACCCCCAAAATTCATGGATTTTGCGGCAGACGAATCCTCCCTTGGCTTGGAAGCCATGGAGCTCTCTGGACCGAGGTGATCGGTGTCGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 80.00% 19.60% 0.25% 0.11% NA
All Indica  2759 78.30% 21.20% 0.33% 0.18% NA
All Japonica  1512 79.30% 20.50% 0.20% 0.00% NA
Aus  269 92.20% 7.80% 0.00% 0.00% NA
Indica I  595 47.40% 51.80% 0.34% 0.50% NA
Indica II  465 96.80% 2.80% 0.22% 0.22% NA
Indica III  913 83.60% 16.30% 0.11% 0.00% NA
Indica Intermediate  786 84.50% 14.80% 0.64% 0.13% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 47.60% 52.00% 0.40% 0.00% NA
Japonica Intermediate  241 85.10% 14.50% 0.41% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103667842 C -> T LOC_Os01g07630.1 synonymous_variant ; p.Ser599Ser; LOW synonymous_codon Average:66.868; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N
vg0103667842 C -> DEL LOC_Os01g07630.1 N frameshift_variant Average:66.868; most accessible tissue: Zhenshan97 panicle, score: 86.432 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0103667842 C T -0.04 -0.04 -0.03 -0.04 -0.04 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103667842 NA 1.13E-08 mr1248 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103667842 NA 1.93E-06 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103667842 NA 1.76E-07 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103667842 NA 2.15E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103667842 NA 3.81E-06 mr1389_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103667842 NA 8.32E-06 mr1553_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103667842 NA 1.06E-14 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103667842 NA 1.48E-07 mr1817_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251