Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0103256578:

Variant ID: vg0103256578 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3256578
Reference Allele: GAlternative Allele: T,C
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAGTTTCAATAGACTTCAAGGAAGCATACCAATACCAGTAACCACATCCAGTGAGATCGCATTGGACTACTCAAACAACCACTTCTCTTCAATAGTACC[G/T,C]
AACTTTGGCATATATCTTGAAAACGCCAGCTATATTAATTTCTCCAATAATAAACTAAGTGGCAATGTACCATCTTCGATTTGTAATGCAAGCAAAGCCA

Reverse complement sequence

TGGCTTTGCTTGCATTACAAATCGAAGATGGTACATTGCCACTTAGTTTATTATTGGAGAAATTAATATAGCTGGCGTTTTCAAGATATATGCCAAAGTT[C/A,G]
GGTACTATTGAAGAGAAGTGGTTGTTTGAGTAGTCCAATGCGATCTCACTGGATGTGGTTACTGGTATTGGTATGCTTCCTTGAAGTCTATTGAAACTGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.80% 26.00% 1.33% 3.83% NA
All Indica  2759 92.50% 4.90% 0.83% 1.70% NA
All Japonica  1512 39.90% 49.30% 2.12% 8.66% NA
Aus  269 13.80% 83.30% 2.97% 0.00% NA
Indica I  595 97.80% 2.00% 0.17% 0.00% NA
Indica II  465 92.50% 6.00% 0.22% 1.29% NA
Indica III  913 88.00% 6.50% 1.64% 3.94% NA
Indica Intermediate  786 93.90% 4.70% 0.76% 0.64% NA
Temperate Japonica  767 56.20% 26.50% 2.74% 14.60% NA
Tropical Japonica  504 18.70% 80.00% 0.60% 0.79% NA
Japonica Intermediate  241 32.80% 57.70% 3.32% 6.22% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 55.60% 41.10% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103256578 G -> T LOC_Os01g06876.1 upstream_gene_variant ; 244.0bp to feature; MODIFIER silent_mutation Average:33.429; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0103256578 G -> T LOC_Os01g06882.1 upstream_gene_variant ; 1366.0bp to feature; MODIFIER silent_mutation Average:33.429; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0103256578 G -> T LOC_Os01g06890.1 upstream_gene_variant ; 2860.0bp to feature; MODIFIER silent_mutation Average:33.429; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0103256578 G -> T LOC_Os01g06870.1 downstream_gene_variant ; 3854.0bp to feature; MODIFIER silent_mutation Average:33.429; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0103256578 G -> T LOC_Os01g06870-LOC_Os01g06876 intergenic_region ; MODIFIER silent_mutation Average:33.429; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0103256578 G -> DEL N N silent_mutation Average:33.429; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0103256578 G -> C LOC_Os01g06876.1 upstream_gene_variant ; 244.0bp to feature; MODIFIER N Average:33.429; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0103256578 G -> C LOC_Os01g06882.1 upstream_gene_variant ; 1366.0bp to feature; MODIFIER N Average:33.429; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0103256578 G -> C LOC_Os01g06890.1 upstream_gene_variant ; 2860.0bp to feature; MODIFIER N Average:33.429; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0103256578 G -> C LOC_Os01g06870.1 downstream_gene_variant ; 3854.0bp to feature; MODIFIER N Average:33.429; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N
vg0103256578 G -> C LOC_Os01g06870-LOC_Os01g06876 intergenic_region ; MODIFIER N Average:33.429; most accessible tissue: Zhenshan97 flower, score: 72.289 N N N N