Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103185620:

Variant ID: vg0103185620 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 3185620
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:

GCTTCAGCAACTTAGCTCCCACGAAACAGCTGGGTTTGGAATCGGCTTTACAGTGGCCATTGTTCTGGTGAGCGAAACGCTGGAACTAGAACATTTCTCG[C/T]
TCCACCAGTAATACTGTACTCCTAATTTAGTAGTGAGCGCGTGCGGTGTGTATGAGCTTGTATGAATCTACTCTTTTACGAACAATGCAATATAATTCGA

Reverse complement sequence

TCGAATTATATTGCATTGTTCGTAAAAGAGTAGATTCATACAAGCTCATACACACCGCACGCGCTCACTACTAAATTAGGAGTACAGTATTACTGGTGGA[G/A]
CGAGAAATGTTCTAGTTCCAGCGTTTCGCTCACCAGAACAATGGCCACTGTAAAGCCGATTCCAAACCCAGCTGTTTCGTGGGAGCTAAGTTGCTGAAGC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.00%	39.80%	0.19%	0.00%	NA
All Indica	2759	89.90%	9.90%	0.22%	0.00%	NA
All Japonica	1512	15.60%	84.20%	0.20%	0.00%	NA
Aus	269	10.00%	90.00%	0.00%	0.00%	NA
Indica I	595	97.10%	2.50%	0.34%	0.00%	NA
Indica II	465	91.00%	9.00%	0.00%	0.00%	NA
Indica III	913	84.30%	15.70%	0.00%	0.00%	NA
Indica Intermediate	786	90.30%	9.20%	0.51%	0.00%	NA
Temperate Japonica	767	16.70%	82.90%	0.39%	0.00%	NA
Tropical Japonica	504	16.10%	83.90%	0.00%	0.00%	NA
Japonica Intermediate	241	11.20%	88.80%	0.00%	0.00%	NA
VI/Aromatic	96	52.10%	47.90%	0.00%	0.00%	NA
Intermediate	90	46.70%	53.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0103185620	C -> T	LOC_Os01g06730.1	downstream_gene_variant ; 274.0bp to feature; MODIFIER	silent_mutation	Average:31.648; most accessible tissue: Callus, score: 46.589	N	N	N	N
vg0103185620	C -> T	LOC_Os01g06740.1	downstream_gene_variant ; 3137.0bp to feature; MODIFIER	silent_mutation	Average:31.648; most accessible tissue: Callus, score: 46.589	N	N	N	N
vg0103185620	C -> T	LOC_Os01g06730-LOC_Os01g06740	intergenic_region ; MODIFIER	silent_mutation	Average:31.648; most accessible tissue: Callus, score: 46.589	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0103185620	NA	3.99E-10	mr1151	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185620	NA	1.32E-18	mr1164	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185620	NA	7.36E-08	mr1174	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185620	3.05E-06	2.69E-12	mr1205	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185620	NA	8.71E-09	mr1249	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185620	NA	2.94E-08	mr1260	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185620	NA	2.92E-11	mr1352	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185620	NA	3.65E-06	mr1358	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185620	NA	5.51E-07	mr1450	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185620	NA	1.60E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185620	NA	1.14E-06	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185620	NA	1.24E-21	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185620	9.21E-08	9.21E-08	mr1967	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103185620	NA	4.00E-12	mr1151_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251