Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0103097560:

Variant ID: vg0103097560 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 3097560
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGGACAGAACATTAAGAAAAGAACACCTTTTCAACAACAAAAAAAATTAAGAGAGAAAAAAAACAACAGAAAAAATTATGGAAGGCGCGTACAATACAG[A/G]
GATCTCGCTCAAACTTGTCATCAACCTCATCGTCACAGCCCCAACCAGACGCTCGCCAAGGCAAGAACCACCCCGACACCAGCACCGGCCGTCACCCTCG

Reverse complement sequence

CGAGGGTGACGGCCGGTGCTGGTGTCGGGGTGGTTCTTGCCTTGGCGAGCGTCTGGTTGGGGCTGTGACGATGAGGTTGATGACAAGTTTGAGCGAGATC[T/C]
CTGTATTGTACGCGCCTTCCATAATTTTTTCTGTTGTTTTTTTTCTCTCTTAATTTTTTTTGTTGTTGAAAAGGTGTTCTTTTCTTAATGTTCTGTCCAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.80% 15.10% 0.13% 0.00% NA
All Indica  2759 98.10% 1.90% 0.04% 0.00% NA
All Japonica  1512 63.60% 36.20% 0.20% 0.00% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 97.40% 2.60% 0.00% 0.00% NA
Indica III  913 96.20% 3.70% 0.11% 0.00% NA
Indica Intermediate  786 99.20% 0.80% 0.00% 0.00% NA
Temperate Japonica  767 41.20% 58.40% 0.39% 0.00% NA
Tropical Japonica  504 96.80% 3.20% 0.00% 0.00% NA
Japonica Intermediate  241 65.10% 34.90% 0.00% 0.00% NA
VI/Aromatic  96 18.80% 80.20% 1.04% 0.00% NA
Intermediate  90 87.80% 11.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0103097560 A -> G LOC_Os01g06580.1 3_prime_UTR_variant ; 33.0bp to feature; MODIFIER silent_mutation Average:86.899; most accessible tissue: Zhenshan97 flag leaf, score: 96.793 N N N N
vg0103097560 A -> G LOC_Os01g06560.1 upstream_gene_variant ; 4695.0bp to feature; MODIFIER silent_mutation Average:86.899; most accessible tissue: Zhenshan97 flag leaf, score: 96.793 N N N N
vg0103097560 A -> G LOC_Os01g06560.2 upstream_gene_variant ; 4695.0bp to feature; MODIFIER silent_mutation Average:86.899; most accessible tissue: Zhenshan97 flag leaf, score: 96.793 N N N N
vg0103097560 A -> G LOC_Os01g06570.1 downstream_gene_variant ; 1630.0bp to feature; MODIFIER silent_mutation Average:86.899; most accessible tissue: Zhenshan97 flag leaf, score: 96.793 N N N N
vg0103097560 A -> G LOC_Os01g06590.1 downstream_gene_variant ; 1868.0bp to feature; MODIFIER silent_mutation Average:86.899; most accessible tissue: Zhenshan97 flag leaf, score: 96.793 N N N N
vg0103097560 A -> G LOC_Os01g06590.2 downstream_gene_variant ; 1868.0bp to feature; MODIFIER silent_mutation Average:86.899; most accessible tissue: Zhenshan97 flag leaf, score: 96.793 N N N N
vg0103097560 A -> G LOC_Os01g06590.3 downstream_gene_variant ; 2086.0bp to feature; MODIFIER silent_mutation Average:86.899; most accessible tissue: Zhenshan97 flag leaf, score: 96.793 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0103097560 A G 0.05 0.04 0.01 0.04 0.04 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0103097560 NA 3.87E-06 mr1354_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103097560 NA 1.69E-07 mr1567_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103097560 NA 3.98E-10 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0103097560 NA 1.72E-14 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251