\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102127805:

Variant ID: vg0102127805 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2127805
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.94, G: 0.06, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


TTTAAGTATATATCGATATAAGAATTATATATTGCTAATATCTACATCCGATCGAGTAGATTTAGTTCTTTATTATCTATTTACAACCGCCGATCGATTT[A/G]
CATATGACATCGGCTCAAAGATAAATGATATGTCATCGGCACCTAGCCGATCGACTATCGTTTATAGGTTTAACCGCGGTTTTCTTTGTTTCTATTTCTT

Reverse complement sequence

AAGAAATAGAAACAAAGAAAACCGCGGTTAAACCTATAAACGATAGTCGATCGGCTAGGTGCCGATGACATATCATTTATCTTTGAGCCGATGTCATATG[T/C]
AAATCGATCGGCGGTTGTAAATAGATAATAAAGAACTAAATCTACTCGATCGGATGTAGATATTAGCAATATATAATTCTTATATCGATATATACTTAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.00% 14.80% 2.12% 31.06% NA
All Indica  2759 45.00% 3.30% 3.30% 48.39% NA
All Japonica  1512 55.00% 37.90% 0.46% 6.61% NA
Aus  269 89.20% 5.90% 0.37% 4.46% NA
Indica I  595 71.10% 0.00% 2.35% 26.55% NA
Indica II  465 37.40% 0.60% 4.09% 57.85% NA
Indica III  913 34.70% 4.80% 2.85% 57.61% NA
Indica Intermediate  786 41.60% 5.70% 4.07% 48.60% NA
Temperate Japonica  767 81.50% 5.30% 0.65% 12.52% NA
Tropical Japonica  504 12.90% 86.50% 0.20% 0.40% NA
Japonica Intermediate  241 58.90% 39.80% 0.41% 0.83% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 58.90% 20.00% 1.11% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102127805 A -> G LOC_Os01g04720.1 upstream_gene_variant ; 2993.0bp to feature; MODIFIER silent_mutation Average:34.605; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0102127805 A -> G LOC_Os01g04720.2 upstream_gene_variant ; 2993.0bp to feature; MODIFIER silent_mutation Average:34.605; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0102127805 A -> G LOC_Os01g04710-LOC_Os01g04720 intergenic_region ; MODIFIER silent_mutation Average:34.605; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N
vg0102127805 A -> DEL N N silent_mutation Average:34.605; most accessible tissue: Zhenshan97 panicle, score: 79.071 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102127805 NA 1.46E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805 2.29E-06 NA mr1142 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805 NA 1.02E-15 mr1142 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805 NA 3.45E-14 mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805 NA 3.10E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805 NA 5.73E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805 NA 1.45E-11 mr1338_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805 NA 1.44E-09 mr1354_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805 NA 4.54E-07 mr1363_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805 NA 8.86E-07 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805 NA 2.80E-06 mr1383_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805 NA 4.52E-13 mr1552_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805 NA 4.26E-07 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805 NA 2.07E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805 NA 5.15E-13 mr1864_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805 NA 4.60E-20 mr1871_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102127805 NA 2.99E-06 mr1966_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251