\
| Variant ID: vg0102116003 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 2116003 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTTCACAGAAATAGATCATACCAATTTACTAAGAATTGTAATTTTATAACCATATTCCTTATAATCTTTAGCACGAGGTAAGACCTCTTGAAAAAATTTC[T/C]
ATGGATTAGAGTGCATGTAACATTCCAATTATTTACTTTTTATATTCCTGTGATTTGAAAATACTTCTAATCGAATAAGCTCATGTATTCTCAAACGGAG
CTCCGTTTGAGAATACATGAGCTTATTCGATTAGAAGTATTTTCAAATCACAGGAATATAAAAAGTAAATAATTGGAATGTTACATGCACTCTAATCCAT[A/G]
GAAATTTTTTCAAGAGGTCTTACCTCGTGCTAAAGATTATAAGGAATATGGTTATAAAATTACAATTCTTAGTAAATTGGTATGATCTATTTCTGTGAAA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.40% | 5.60% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 89.50% | 10.40% | 0.07% | 0.00% | NA |
| Aus | 269 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.60% | 5.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 87.10% | 12.70% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 75.50% | 24.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0102116003 | T -> C | LOC_Os01g04699.1 | upstream_gene_variant ; 4352.0bp to feature; MODIFIER | silent_mutation | Average:65.157; most accessible tissue: Callus, score: 98.992 | N | N | N | N |
| vg0102116003 | T -> C | LOC_Os01g04710.1 | upstream_gene_variant ; 4378.0bp to feature; MODIFIER | silent_mutation | Average:65.157; most accessible tissue: Callus, score: 98.992 | N | N | N | N |
| vg0102116003 | T -> C | LOC_Os01g04699-LOC_Os01g04710 | intergenic_region ; MODIFIER | silent_mutation | Average:65.157; most accessible tissue: Callus, score: 98.992 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0102116003 | 7.77E-09 | NA | mr1023 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102116003 | 2.71E-06 | NA | mr1023 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102116003 | 3.72E-07 | NA | mr1079 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102116003 | 7.13E-08 | NA | mr1142 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102116003 | 2.02E-06 | NA | mr1142 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102116003 | 1.21E-08 | NA | mr1489 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102116003 | 4.31E-08 | NA | mr1491 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102116003 | 9.28E-06 | NA | mr1491 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0102116003 | 1.41E-07 | NA | mr1778 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |