\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0102116003:

Variant ID: vg0102116003 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 2116003
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTCACAGAAATAGATCATACCAATTTACTAAGAATTGTAATTTTATAACCATATTCCTTATAATCTTTAGCACGAGGTAAGACCTCTTGAAAAAATTTC[T/C]
ATGGATTAGAGTGCATGTAACATTCCAATTATTTACTTTTTATATTCCTGTGATTTGAAAATACTTCTAATCGAATAAGCTCATGTATTCTCAAACGGAG

Reverse complement sequence

CTCCGTTTGAGAATACATGAGCTTATTCGATTAGAAGTATTTTCAAATCACAGGAATATAAAAAGTAAATAATTGGAATGTTACATGCACTCTAATCCAT[A/G]
GAAATTTTTTCAAGAGGTCTTACCTCGTGCTAAAGATTATAAGGAATATGGTTATAAAATTACAATTCTTAGTAAATTGGTATGATCTATTTCTGTGAAA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.40% 5.60% 0.02% 0.00% NA
All Indica  2759 96.80% 3.20% 0.00% 0.00% NA
All Japonica  1512 89.50% 10.40% 0.07% 0.00% NA
Aus  269 92.90% 7.10% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 94.60% 5.40% 0.00% 0.00% NA
Indica Intermediate  786 95.40% 4.60% 0.00% 0.00% NA
Temperate Japonica  767 95.40% 4.60% 0.00% 0.00% NA
Tropical Japonica  504 87.10% 12.70% 0.20% 0.00% NA
Japonica Intermediate  241 75.50% 24.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0102116003 T -> C LOC_Os01g04699.1 upstream_gene_variant ; 4352.0bp to feature; MODIFIER silent_mutation Average:65.157; most accessible tissue: Callus, score: 98.992 N N N N
vg0102116003 T -> C LOC_Os01g04710.1 upstream_gene_variant ; 4378.0bp to feature; MODIFIER silent_mutation Average:65.157; most accessible tissue: Callus, score: 98.992 N N N N
vg0102116003 T -> C LOC_Os01g04699-LOC_Os01g04710 intergenic_region ; MODIFIER silent_mutation Average:65.157; most accessible tissue: Callus, score: 98.992 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0102116003 7.77E-09 NA mr1023 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116003 2.71E-06 NA mr1023 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116003 3.72E-07 NA mr1079 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116003 7.13E-08 NA mr1142 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116003 2.02E-06 NA mr1142 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116003 1.21E-08 NA mr1489 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116003 4.31E-08 NA mr1491 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116003 9.28E-06 NA mr1491 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0102116003 1.41E-07 NA mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251