\
| Variant ID: vg0101356395 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 1356395 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTCAAATTATGGGTTTATATTTCCAACATCAATGGCACCATAGCACTTCACAGTGGAGGAAGAACAGGAAAAATTAGAAATTAATCTAATTACTGCATTC[C/T]
GAGTTGTAAAAATAATGTGAATAATGTGCATTTATTTGCATTTCATTCTAAAACCTAGAAAAAGTAGTAAAGAAATCGAATGTCTGGAATTTGTGTATTT
AAATACACAAATTCCAGACATTCGATTTCTTTACTACTTTTTCTAGGTTTTAGAATGAAATGCAAATAAATGCACATTATTCACATTATTTTTACAACTC[G/A]
GAATGCAGTAATTAGATTAATTTCTAATTTTTCCTGTTCTTCCTCCACTGTGAAGTGCTATGGTGCCATTGATGTTGGAAATATAAACCCATAATTTGAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.50% | 8.50% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 10.80% | 88.50% | 0.74% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 80.20% | 19.80% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0101356395 | C -> T | LOC_Os01g03360.1 | upstream_gene_variant ; 1593.0bp to feature; MODIFIER | silent_mutation | Average:42.366; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0101356395 | C -> T | LOC_Os01g03370.1 | downstream_gene_variant ; 206.0bp to feature; MODIFIER | silent_mutation | Average:42.366; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| vg0101356395 | C -> T | LOC_Os01g03360-LOC_Os01g03370 | intergenic_region ; MODIFIER | silent_mutation | Average:42.366; most accessible tissue: Minghui63 panicle, score: 66.554 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0101356395 | NA | 5.65E-06 | mr1029 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101356395 | NA | 1.03E-10 | mr1471 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101356395 | NA | 2.06E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101356395 | NA | 1.59E-20 | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101356395 | 4.41E-06 | NA | mr1529_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101356395 | NA | 1.93E-15 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101356395 | NA | 2.27E-09 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101356395 | NA | 1.73E-17 | mr1587_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101356395 | NA | 1.05E-13 | mr1803_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0101356395 | NA | 5.71E-15 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |