\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0101356395:

Variant ID: vg0101356395 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 1356395
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCAAATTATGGGTTTATATTTCCAACATCAATGGCACCATAGCACTTCACAGTGGAGGAAGAACAGGAAAAATTAGAAATTAATCTAATTACTGCATTC[C/T]
GAGTTGTAAAAATAATGTGAATAATGTGCATTTATTTGCATTTCATTCTAAAACCTAGAAAAAGTAGTAAAGAAATCGAATGTCTGGAATTTGTGTATTT

Reverse complement sequence

AAATACACAAATTCCAGACATTCGATTTCTTTACTACTTTTTCTAGGTTTTAGAATGAAATGCAAATAAATGCACATTATTCACATTATTTTTACAACTC[G/A]
GAATGCAGTAATTAGATTAATTTCTAATTTTTCCTGTTCTTCCTCCACTGTGAAGTGCTATGGTGCCATTGATGTTGGAAATATAAACCCATAATTTGAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.50% 8.50% 0.04% 0.00% NA
All Indica  2759 95.40% 4.60% 0.00% 0.00% NA
All Japonica  1512 99.80% 0.20% 0.00% 0.00% NA
Aus  269 10.80% 88.50% 0.74% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 93.10% 6.90% 0.00% 0.00% NA
Indica Intermediate  786 92.10% 7.90% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 80.20% 19.80% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0101356395 C -> T LOC_Os01g03360.1 upstream_gene_variant ; 1593.0bp to feature; MODIFIER silent_mutation Average:42.366; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0101356395 C -> T LOC_Os01g03370.1 downstream_gene_variant ; 206.0bp to feature; MODIFIER silent_mutation Average:42.366; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N
vg0101356395 C -> T LOC_Os01g03360-LOC_Os01g03370 intergenic_region ; MODIFIER silent_mutation Average:42.366; most accessible tissue: Minghui63 panicle, score: 66.554 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0101356395 NA 5.65E-06 mr1029 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395 NA 1.03E-10 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395 NA 2.06E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395 NA 1.59E-20 mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395 4.41E-06 NA mr1529_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395 NA 1.93E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395 NA 2.27E-09 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395 NA 1.73E-17 mr1587_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395 NA 1.05E-13 mr1803_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0101356395 NA 5.71E-15 mr1961_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251