Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0100745511:

Variant ID: vg0100745511 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 745511
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


AGTATATGATTGATTGTCCCCTATTATAGCAAGCAGTGATCATACAGCCTTCCTGCTCTCTCTATTCTGTTTGCAATCCTCTTCACCCTAATTTTCAATG[T/C]
ACCTCTGGCCGTTGCAGTACACACACACACACACACACACACACAGAGAGAGAGAGAGAGAGAGAGAGAGATGGGTACCATTCTCGCAACAGCCTTCCTG

Reverse complement sequence

CAGGAAGGCTGTTGCGAGAATGGTACCCATCTCTCTCTCTCTCTCTCTCTCTCTCTGTGTGTGTGTGTGTGTGTGTGTGTGTACTGCAACGGCCAGAGGT[A/G]
CATTGAAAATTAGGGTGAAGAGGATTGCAAACAGAATAGAGAGAGCAGGAAGGCTGTATGATCACTGCTTGCTATAATAGGGGACAATCAATCATATACT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.90% 36.00% 0.13% 0.00% NA
All Indica  2759 49.30% 50.50% 0.22% 0.00% NA
All Japonica  1512 97.40% 2.60% 0.00% 0.00% NA
Aus  269 20.80% 79.20% 0.00% 0.00% NA
Indica I  595 68.20% 31.60% 0.17% 0.00% NA
Indica II  465 76.60% 23.00% 0.43% 0.00% NA
Indica III  913 17.60% 82.10% 0.22% 0.00% NA
Indica Intermediate  786 55.50% 44.40% 0.13% 0.00% NA
Temperate Japonica  767 95.20% 4.80% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 63.50% 36.50% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0100745511 T -> C LOC_Os01g02360.1 5_prime_UTR_variant ; 71.0bp to feature; MODIFIER silent_mutation Average:83.911; most accessible tissue: Zhenshan97 root, score: 93.067 N N N N
vg0100745511 T -> C LOC_Os01g02334.1 upstream_gene_variant ; 3717.0bp to feature; MODIFIER silent_mutation Average:83.911; most accessible tissue: Zhenshan97 root, score: 93.067 N N N N
vg0100745511 T -> C LOC_Os01g02350.1 upstream_gene_variant ; 355.0bp to feature; MODIFIER silent_mutation Average:83.911; most accessible tissue: Zhenshan97 root, score: 93.067 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0100745511 T C 0.08 0.01 0.0 -0.01 0.03 0.05

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0100745511 NA 1.30E-08 mr1030_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100745511 NA 9.40E-06 mr1060_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100745511 NA 9.53E-10 mr1221_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100745511 NA 1.44E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100745511 NA 4.49E-06 mr1296_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100745511 NA 1.81E-09 mr1388_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100745511 NA 6.27E-06 mr1568_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100745511 NA 6.51E-09 mr1576_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100745511 NA 7.60E-08 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100745511 NA 1.70E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100745511 NA 8.60E-06 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0100745511 NA 8.18E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251