\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1227491928:

Variant ID: vg1227491928 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 27491928
Reference Allele: AAlternative Allele: AGAGGGAG
Primary Allele: ASecondary Allele: AGAGGGAG

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGCACAGAAACTGTCATCCTTGGCCATTGCTAGCTGCTAGCTGTTACAAGGTTTGTTGGGTAGCCTAGCTACACAAGAAAGAGAAGGAGGAGGAGAAGGA[A/AGAGGGAG]
GAGGGAGGAGGAAAAGAAAGAAGAGCTAGAGAAGAAGTTTGTTGTATTTGCAGTAGTAAGAAGAAAGAAAGAAAGTAGCAGGTAGAGAGAGAGATGGCGG

Reverse complement sequence

CCGCCATCTCTCTCTCTACCTGCTACTTTCTTTCTTTCTTCTTACTACTGCAAATACAACAAACTTCTTCTCTAGCTCTTCTTTCTTTTCCTCCTCCCTC[T/CTCCCTCT]
TCCTTCTCCTCCTCCTTCTCTTTCTTGTGTAGCTAGGCTACCCAACAAACCTTGTAACAGCTAGCAGCTAGCAATGGCCAAGGATGACAGTTTCTGTGCC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of AGAGGGAG(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 37.20% 2.50% 2.03% 58.25% NA
All Indica  2759 4.50% 0.60% 1.20% 93.73% NA
All Japonica  1512 99.20% 0.00% 0.00% 0.79% NA
Aus  269 4.10% 35.70% 21.19% 39.03% NA
Indica I  595 2.20% 0.20% 1.01% 96.64% NA
Indica II  465 4.50% 0.00% 1.94% 93.55% NA
Indica III  913 4.70% 0.50% 1.31% 93.43% NA
Indica Intermediate  786 6.00% 1.30% 0.76% 91.98% NA
Temperate Japonica  767 99.60% 0.00% 0.00% 0.39% NA
Tropical Japonica  504 99.20% 0.00% 0.00% 0.79% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 81.20% 5.20% 5.21% 8.33% NA
Intermediate  90 52.20% 0.00% 1.11% 46.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1227491928 A -> DEL N N silent_mutation Average:91.136; most accessible tissue: Zhenshan97 flower, score: 95.036 N N N N
vg1227491928 A -> AGAGGGAG LOC_Os12g44350.1 5_prime_UTR_variant ; 82.0bp to feature; MODIFIER silent_mutation Average:91.136; most accessible tissue: Zhenshan97 flower, score: 95.036 N N N N
vg1227491928 A -> AGAGGGAG LOC_Os12g44340.1 downstream_gene_variant ; 339.0bp to feature; MODIFIER silent_mutation Average:91.136; most accessible tissue: Zhenshan97 flower, score: 95.036 N N N N
vg1227491928 A -> AGAGGGAG LOC_Os12g44360.1 downstream_gene_variant ; 3832.0bp to feature; MODIFIER silent_mutation Average:91.136; most accessible tissue: Zhenshan97 flower, score: 95.036 N N N N
vg1227491928 A -> AGAGGGAG LOC_Os12g44360.2 downstream_gene_variant ; 2472.0bp to feature; MODIFIER silent_mutation Average:91.136; most accessible tissue: Zhenshan97 flower, score: 95.036 N N N N
vg1227491928 A -> AGAGGGAG LOC_Os12g44360.3 downstream_gene_variant ; 3832.0bp to feature; MODIFIER silent_mutation Average:91.136; most accessible tissue: Zhenshan97 flower, score: 95.036 N N N N
vg1227491928 A -> AGAGGGAG LOC_Os12g44360.4 downstream_gene_variant ; 3832.0bp to feature; MODIFIER silent_mutation Average:91.136; most accessible tissue: Zhenshan97 flower, score: 95.036 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1227491928 A AGAGG* 0.1 -0.04 -0.08 -0.04 -0.06 -0.15

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1227491928 6.92E-06 NA mr1151_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227491928 2.37E-06 6.90E-07 mr1263_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251