\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1227422436:

Variant ID: vg1227422436 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 27422436
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGAGTTCTAGTATTTTCATGCATGTACCAGTACTAGTTGTGTTCAGAAAAGTTCCTAGCCATCCTATAAATAGGCAGCTATGTCCTAGATGTGATGCTG[T/C]
TGTCCAACAATCAATGTAACGTGCAATACTTGAGCAAAGCATAACCAGTTTGTCAAACAAACACAGAGCTTCTCTCCTCTGTTCTCCTTCTCTGTTCCAT

Reverse complement sequence

ATGGAACAGAGAAGGAGAACAGAGGAGAGAAGCTCTGTGTTTGTTTGACAAACTGGTTATGCTTTGCTCAAGTATTGCACGTTACATTGATTGTTGGACA[A/G]
CAGCATCACATCTAGGACATAGCTGCCTATTTATAGGATGGCTAGGAACTTTTCTGAACACAACTAGTACTGGTACATGCATGAAAATACTAGAACTCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.40% 7.30% 10.64% 54.66% NA
All Indica  2759 2.00% 0.50% 10.91% 86.52% NA
All Japonica  1512 77.40% 18.30% 3.64% 0.66% NA
Aus  269 1.50% 0.40% 45.72% 52.42% NA
Indica I  595 1.00% 0.20% 9.58% 89.24% NA
Indica II  465 2.20% 0.00% 24.30% 73.55% NA
Indica III  913 2.10% 0.80% 3.94% 93.21% NA
Indica Intermediate  786 2.70% 0.90% 12.09% 84.35% NA
Temperate Japonica  767 78.20% 15.90% 5.48% 0.39% NA
Tropical Japonica  504 83.10% 15.30% 0.79% 0.79% NA
Japonica Intermediate  241 63.10% 32.00% 3.73% 1.24% NA
VI/Aromatic  96 26.00% 54.20% 9.38% 10.42% NA
Intermediate  90 41.10% 3.30% 16.67% 38.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1227422436 T -> C LOC_Os12g44210.1 5_prime_UTR_premature_start_codon_gain_variant ; LOW silent_mutation Average:44.798; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg1227422436 T -> C LOC_Os12g44210.1 5_prime_UTR_variant ; 250.0bp to feature; MODIFIER silent_mutation Average:44.798; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg1227422436 T -> C LOC_Os12g44220.1 upstream_gene_variant ; 3874.0bp to feature; MODIFIER silent_mutation Average:44.798; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg1227422436 T -> C LOC_Os12g44220.2 upstream_gene_variant ; 3874.0bp to feature; MODIFIER silent_mutation Average:44.798; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg1227422436 T -> C LOC_Os12g44200.1 downstream_gene_variant ; 249.0bp to feature; MODIFIER silent_mutation Average:44.798; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N
vg1227422436 T -> DEL N N silent_mutation Average:44.798; most accessible tissue: Zhenshan97 root, score: 68.289 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1227422436 5.58E-07 NA mr1679 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227422436 NA 9.45E-06 mr1691 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227422436 NA 8.08E-08 mr1829 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227422436 5.54E-07 NA mr1679_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227422436 NA 4.09E-07 mr1679_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227422436 NA 5.10E-10 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251