\
| Variant ID: vg1227422436 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 27422436 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GTGAGTTCTAGTATTTTCATGCATGTACCAGTACTAGTTGTGTTCAGAAAAGTTCCTAGCCATCCTATAAATAGGCAGCTATGTCCTAGATGTGATGCTG[T/C]
TGTCCAACAATCAATGTAACGTGCAATACTTGAGCAAAGCATAACCAGTTTGTCAAACAAACACAGAGCTTCTCTCCTCTGTTCTCCTTCTCTGTTCCAT
ATGGAACAGAGAAGGAGAACAGAGGAGAGAAGCTCTGTGTTTGTTTGACAAACTGGTTATGCTTTGCTCAAGTATTGCACGTTACATTGATTGTTGGACA[A/G]
CAGCATCACATCTAGGACATAGCTGCCTATTTATAGGATGGCTAGGAACTTTTCTGAACACAACTAGTACTGGTACATGCATGAAAATACTAGAACTCAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 27.40% | 7.30% | 10.64% | 54.66% | NA |
| All Indica | 2759 | 2.00% | 0.50% | 10.91% | 86.52% | NA |
| All Japonica | 1512 | 77.40% | 18.30% | 3.64% | 0.66% | NA |
| Aus | 269 | 1.50% | 0.40% | 45.72% | 52.42% | NA |
| Indica I | 595 | 1.00% | 0.20% | 9.58% | 89.24% | NA |
| Indica II | 465 | 2.20% | 0.00% | 24.30% | 73.55% | NA |
| Indica III | 913 | 2.10% | 0.80% | 3.94% | 93.21% | NA |
| Indica Intermediate | 786 | 2.70% | 0.90% | 12.09% | 84.35% | NA |
| Temperate Japonica | 767 | 78.20% | 15.90% | 5.48% | 0.39% | NA |
| Tropical Japonica | 504 | 83.10% | 15.30% | 0.79% | 0.79% | NA |
| Japonica Intermediate | 241 | 63.10% | 32.00% | 3.73% | 1.24% | NA |
| VI/Aromatic | 96 | 26.00% | 54.20% | 9.38% | 10.42% | NA |
| Intermediate | 90 | 41.10% | 3.30% | 16.67% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1227422436 | T -> C | LOC_Os12g44210.1 | 5_prime_UTR_premature_start_codon_gain_variant ; LOW | silent_mutation | Average:44.798; most accessible tissue: Zhenshan97 root, score: 68.289 | N | N | N | N |
| vg1227422436 | T -> C | LOC_Os12g44210.1 | 5_prime_UTR_variant ; 250.0bp to feature; MODIFIER | silent_mutation | Average:44.798; most accessible tissue: Zhenshan97 root, score: 68.289 | N | N | N | N |
| vg1227422436 | T -> C | LOC_Os12g44220.1 | upstream_gene_variant ; 3874.0bp to feature; MODIFIER | silent_mutation | Average:44.798; most accessible tissue: Zhenshan97 root, score: 68.289 | N | N | N | N |
| vg1227422436 | T -> C | LOC_Os12g44220.2 | upstream_gene_variant ; 3874.0bp to feature; MODIFIER | silent_mutation | Average:44.798; most accessible tissue: Zhenshan97 root, score: 68.289 | N | N | N | N |
| vg1227422436 | T -> C | LOC_Os12g44200.1 | downstream_gene_variant ; 249.0bp to feature; MODIFIER | silent_mutation | Average:44.798; most accessible tissue: Zhenshan97 root, score: 68.289 | N | N | N | N |
| vg1227422436 | T -> DEL | N | N | silent_mutation | Average:44.798; most accessible tissue: Zhenshan97 root, score: 68.289 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1227422436 | 5.58E-07 | NA | mr1679 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227422436 | NA | 9.45E-06 | mr1691 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227422436 | NA | 8.08E-08 | mr1829 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227422436 | 5.54E-07 | NA | mr1679_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227422436 | NA | 4.09E-07 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227422436 | NA | 5.10E-10 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |