\
| Variant ID: vg1227333750 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 27333750 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GCATTCTGCATTCTACCTGTGCTTGTGAGTAAAAATATTATATCGCGTGTGTGGCTAGATCAATAGCGATCAAGGCGGATGAAAAATGATCGAGAATTGA[C/T]
GGAAGTGTTAAAAATTAGAACGGATAACTACTAAAGTGAACCGGTATTTTTTGGTGCTATAAAAAAAACGTGAACTTTTAATGTTATATAACCAATTTTA
TAAAATTGGTTATATAACATTAAAAGTTCACGTTTTTTTTATAGCACCAAAAAATACCGGTTCACTTTAGTAGTTATCCGTTCTAATTTTTAACACTTCC[G/A]
TCAATTCTCGATCATTTTTCATCCGCCTTGATCGCTATTGATCTAGCCACACACGCGATATAATATTTTTACTCACAAGCACAGGTAGAATGCAGAATGC
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.50% | 6.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 98.60% | 1.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 93.70% | 6.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 38.30% | 61.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.90% | 3.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 88.70% | 11.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1227333750 | C -> T | LOC_Os12g44070.1 | upstream_gene_variant ; 1671.0bp to feature; MODIFIER | silent_mutation | Average:53.538; most accessible tissue: Callus, score: 97.424 | N | N | N | N |
| vg1227333750 | C -> T | LOC_Os12g44080.1 | downstream_gene_variant ; 2339.0bp to feature; MODIFIER | silent_mutation | Average:53.538; most accessible tissue: Callus, score: 97.424 | N | N | N | N |
| vg1227333750 | C -> T | LOC_Os12g44070-LOC_Os12g44080 | intergenic_region ; MODIFIER | silent_mutation | Average:53.538; most accessible tissue: Callus, score: 97.424 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1227333750 | 1.33E-06 | NA | mr1024_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227333750 | 2.43E-06 | 2.43E-06 | mr1024_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227333750 | NA | 2.69E-09 | mr1582_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |