\
| Variant ID: vg1227323057 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 27323057 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.98, A: 0.02, others allele: 0.00, population size: 111. )
TCCTTATCCGGAACTCCTTCTATATACGAGATTACGAGGTTTGTTTCCGTATAGAACATGGTATGTGGTGGGCCTCACCGAGCTTAGTCGATTACTATTG[G/A]
GTATGTGGTATCAATAACCCTTATAGTATGCATGCAACCAATAAGTACTAAGATGACATTTTGGGTTCCGGTCAACAATTTAATTTAGCACATAGAGATT
AATCTCTATGTGCTAAATTAAATTGTTGACCGGAACCCAAAATGTCATCTTAGTACTTATTGGTTGCATGCATACTATAAGGGTTATTGATACCACATAC[C/T]
CAATAGTAATCGACTAAGCTCGGTGAGGCCCACCACATACCATGTTCTATACGGAAACAAACCTCGTAATCTCGTATATAGAAGGAGTTCCGGATAAGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.80% | 26.90% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 54.70% | 44.90% | 0.47% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 81.20% | 17.80% | 1.01% | 0.00% | NA |
| Indica II | 465 | 27.70% | 72.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 52.40% | 47.10% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 53.20% | 46.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 22.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1227323057 | G -> A | LOC_Os12g44060.1 | upstream_gene_variant ; 1547.0bp to feature; MODIFIER | silent_mutation | Average:51.285; most accessible tissue: Callus, score: 70.329 | N | N | N | N |
| vg1227323057 | G -> A | LOC_Os12g44050-LOC_Os12g44060 | intergenic_region ; MODIFIER | silent_mutation | Average:51.285; most accessible tissue: Callus, score: 70.329 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1227323057 | NA | 6.38E-09 | mr1174 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227323057 | NA | 1.79E-11 | mr1174_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227323057 | NA | 3.96E-12 | mr1330_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227323057 | NA | 6.89E-06 | mr1341_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227323057 | NA | 2.42E-08 | mr1347_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227323057 | 2.15E-06 | NA | mr1350_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227323057 | NA | 9.99E-06 | mr1350_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227323057 | NA | 1.09E-06 | mr1418_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227323057 | NA | 1.23E-08 | mr1449_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227323057 | NA | 2.30E-06 | mr1558_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227323057 | NA | 6.99E-06 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227323057 | NA | 4.16E-07 | mr1992_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |