\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1227320261:

Variant ID: vg1227320261 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 27320261
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGAAGATTTGTTGAAGAGATGATGAAGAAGATAGAAGAGATAAAGATTTAAATGGACCCATGTCTCATTCTTGATCAAGACATTTGTGGATATAAATAT[A/G]
ATGTACAGTTCTATATTTGTGGATGCAAGGATGATTCCAAAGATTTTAAATTTTGTATGATATGGATGATTCTAAAGTTTAACTTATGTCATGTCACGAA

Reverse complement sequence

TTCGTGACATGACATAAGTTAAACTTTAGAATCATCCATATCATACAAAATTTAAAATCTTTGGAATCATCCTTGCATCCACAAATATAGAACTGTACAT[T/C]
ATATTTATATCCACAAATGTCTTGATCAAGAATGAGACATGGGTCCATTTAAATCTTTATCTCTTCTATCTTCTTCATCATCTCTTCAACAAATCTTCAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 49.90% 37.80% 12.31% 0.00% NA
All Indica  2759 82.80% 3.70% 13.52% 0.00% NA
All Japonica  1512 0.50% 99.20% 0.26% 0.00% NA
Aus  269 11.50% 21.90% 66.54% 0.00% NA
Indica I  595 90.30% 1.80% 7.90% 0.00% NA
Indica II  465 77.60% 2.40% 20.00% 0.00% NA
Indica III  913 82.40% 5.10% 12.49% 0.00% NA
Indica Intermediate  786 80.80% 4.10% 15.14% 0.00% NA
Temperate Japonica  767 0.10% 99.60% 0.26% 0.00% NA
Tropical Japonica  504 0.60% 99.20% 0.20% 0.00% NA
Japonica Intermediate  241 1.70% 97.90% 0.41% 0.00% NA
VI/Aromatic  96 4.20% 81.20% 14.58% 0.00% NA
Intermediate  90 33.30% 53.30% 13.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1227320261 A -> G LOC_Os12g44050.1 upstream_gene_variant ; 2971.0bp to feature; MODIFIER silent_mutation Average:14.495; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1227320261 A -> G LOC_Os12g44060.1 upstream_gene_variant ; 4343.0bp to feature; MODIFIER silent_mutation Average:14.495; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1227320261 A -> G LOC_Os12g44040.1 downstream_gene_variant ; 3934.0bp to feature; MODIFIER silent_mutation Average:14.495; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1227320261 A -> G LOC_Os12g44040.3 downstream_gene_variant ; 3934.0bp to feature; MODIFIER silent_mutation Average:14.495; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1227320261 A -> G LOC_Os12g44040.4 downstream_gene_variant ; 3929.0bp to feature; MODIFIER silent_mutation Average:14.495; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1227320261 A -> G LOC_Os12g44040.2 downstream_gene_variant ; 3934.0bp to feature; MODIFIER silent_mutation Average:14.495; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N
vg1227320261 A -> G LOC_Os12g44050-LOC_Os12g44060 intergenic_region ; MODIFIER silent_mutation Average:14.495; most accessible tissue: Minghui63 panicle, score: 25.313 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1227320261 NA 7.40E-69 mr1014 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 4.95E-20 mr1021 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 7.32E-28 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 2.43E-35 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 1.21E-45 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 8.01E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 6.80E-47 mr1194 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 6.31E-14 mr1205 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 8.47E-27 mr1223 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 3.97E-14 mr1361 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 2.06E-25 mr1375 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 6.32E-35 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 1.31E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 6.81E-82 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 5.90E-07 mr1690 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 9.69E-29 mr1723 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 3.30E-87 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 1.46E-10 mr1775 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 7.54E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 6.15E-06 9.47E-106 mr1987 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 1.33E-14 mr1324_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 6.73E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 5.78E-33 mr1723_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261 NA 6.97E-11 mr1781_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251