Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1227320261:

Variant ID: vg1227320261 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 27320261
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGAAGATTTGTTGAAGAGATGATGAAGAAGATAGAAGAGATAAAGATTTAAATGGACCCATGTCTCATTCTTGATCAAGACATTTGTGGATATAAATAT[A/G]
ATGTACAGTTCTATATTTGTGGATGCAAGGATGATTCCAAAGATTTTAAATTTTGTATGATATGGATGATTCTAAAGTTTAACTTATGTCATGTCACGAA

Reverse complement sequence

TTCGTGACATGACATAAGTTAAACTTTAGAATCATCCATATCATACAAAATTTAAAATCTTTGGAATCATCCTTGCATCCACAAATATAGAACTGTACAT[T/C]
ATATTTATATCCACAAATGTCTTGATCAAGAATGAGACATGGGTCCATTTAAATCTTTATCTCTTCTATCTTCTTCATCATCTCTTCAACAAATCTTCAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	49.90%	37.80%	12.31%	0.00%	NA
All Indica	2759	82.80%	3.70%	13.52%	0.00%	NA
All Japonica	1512	0.50%	99.20%	0.26%	0.00%	NA
Aus	269	11.50%	21.90%	66.54%	0.00%	NA
Indica I	595	90.30%	1.80%	7.90%	0.00%	NA
Indica II	465	77.60%	2.40%	20.00%	0.00%	NA
Indica III	913	82.40%	5.10%	12.49%	0.00%	NA
Indica Intermediate	786	80.80%	4.10%	15.14%	0.00%	NA
Temperate Japonica	767	0.10%	99.60%	0.26%	0.00%	NA
Tropical Japonica	504	0.60%	99.20%	0.20%	0.00%	NA
Japonica Intermediate	241	1.70%	97.90%	0.41%	0.00%	NA
VI/Aromatic	96	4.20%	81.20%	14.58%	0.00%	NA
Intermediate	90	33.30%	53.30%	13.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1227320261	A -> G	LOC_Os12g44050.1	upstream_gene_variant ; 2971.0bp to feature; MODIFIER	silent_mutation	Average:14.495; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1227320261	A -> G	LOC_Os12g44060.1	upstream_gene_variant ; 4343.0bp to feature; MODIFIER	silent_mutation	Average:14.495; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1227320261	A -> G	LOC_Os12g44040.1	downstream_gene_variant ; 3934.0bp to feature; MODIFIER	silent_mutation	Average:14.495; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1227320261	A -> G	LOC_Os12g44040.3	downstream_gene_variant ; 3934.0bp to feature; MODIFIER	silent_mutation	Average:14.495; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1227320261	A -> G	LOC_Os12g44040.4	downstream_gene_variant ; 3929.0bp to feature; MODIFIER	silent_mutation	Average:14.495; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1227320261	A -> G	LOC_Os12g44040.2	downstream_gene_variant ; 3934.0bp to feature; MODIFIER	silent_mutation	Average:14.495; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N
vg1227320261	A -> G	LOC_Os12g44050-LOC_Os12g44060	intergenic_region ; MODIFIER	silent_mutation	Average:14.495; most accessible tissue: Minghui63 panicle, score: 25.313	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1227320261	NA	7.40E-69	mr1014	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	4.95E-20	mr1021	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	7.32E-28	mr1024	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	2.43E-35	mr1105	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	1.21E-45	mr1152	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	8.01E-11	mr1172	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	6.80E-47	mr1194	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	6.31E-14	mr1205	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	8.47E-27	mr1223	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	3.97E-14	mr1361	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	2.06E-25	mr1375	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	6.32E-35	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	1.31E-08	mr1595	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	6.81E-82	mr1672	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	5.90E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	9.69E-29	mr1723	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	3.30E-87	mr1758	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	1.46E-10	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	7.54E-07	mr1781	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	6.15E-06	9.47E-106	mr1987	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	1.33E-14	mr1324_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	6.73E-08	mr1335_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	5.78E-33	mr1723_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227320261	NA	6.97E-11	mr1781_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251