\
| Variant ID: vg1227287870 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 27287870 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 268. )
CTGCAGTTAGCCCACTGAAGGAGATCATCAGCAAAACATCTGCAGGTTTCACACATTCAGACTTAAAAAAATGTCATTCACAAAATTTTTGAGTTTCAAC[A/G]
AGTCTAAGCAAGTGTCTATGAAAAATCAAATCAAAGCATCCTTAACTTACCACAGGATTGGAGCACACTCCATTTCATTACAAAGAATTTGTGTTGTGTG
CACACAACACAAATTCTTTGTAATGAAATGGAGTGTGCTCCAATCCTGTGGTAAGTTAAGGATGCTTTGATTTGATTTTTCATAGACACTTGCTTAGACT[T/C]
GTTGAAACTCAAAAATTTTGTGAATGACATTTTTTTAAGTCTGAATGTGTGAAACCTGCAGATGTTTTGCTGATGATCTCCTTCAGTGGGCTAACTGCAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.60% | 33.40% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 97.60% | 2.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 7.30% | 92.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.10% | 3.90% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.70% | 2.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 12.30% | 87.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 5.40% | 94.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 24.00% | 76.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 56.70% | 43.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1227287870 | A -> G | LOC_Os12g43960.1 | upstream_gene_variant ; 1902.0bp to feature; MODIFIER | silent_mutation | Average:53.664; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| vg1227287870 | A -> G | LOC_Os12g43970.1 | intron_variant ; MODIFIER | silent_mutation | Average:53.664; most accessible tissue: Zhenshan97 panicle, score: 69.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1227287870 | 3.27E-06 | 1.61E-30 | mr1024 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | NA | 1.32E-35 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | NA | 7.02E-06 | mr1565 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | NA | 1.16E-13 | mr1579 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | NA | 4.92E-31 | mr1647 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | NA | 2.65E-35 | mr1670 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | NA | 5.54E-14 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | NA | 2.11E-08 | mr1776 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | NA | 1.87E-30 | mr1922 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | NA | 8.58E-06 | mr1922 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | 5.98E-08 | 1.91E-28 | mr1024_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | 2.18E-07 | 2.18E-07 | mr1024_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | 3.19E-06 | NA | mr1410_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | NA | 1.17E-43 | mr1542_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | 5.74E-06 | NA | mr1565_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | NA | 5.74E-07 | mr1565_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | NA | 3.08E-20 | mr1657_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | 6.26E-07 | 6.26E-07 | mr1915_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227287870 | NA | 1.44E-19 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |