\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1227225152:

Variant ID: vg1227225152 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 27225152
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 309. )

Flanking Sequence (100 bp) in Reference Genome:


AGGTGCTAAGATGGTGGAGCAGGTTCTAATCCGATGGTCAGGTCCAGACTCTGCTGTGGTGACATGGGAAAATCTACAAGAACTACAACAACGTTTTCCT[C/T]
AGACAAAAGCTTGGGAACAAGCTTCGTTTCAAGGAAGGGGGAATGTCATGGCATGCACTACTTCAGGACCATCTCAGGAAGGCGAAGAGCAAGGCGGGAG

Reverse complement sequence

CTCCCGCCTTGCTCTTCGCCTTCCTGAGATGGTCCTGAAGTAGTGCATGCCATGACATTCCCCCTTCCTTGAAACGAAGCTTGTTCCCAAGCTTTTGTCT[G/A]
AGGAAAACGTTGTTGTAGTTCTTGTAGATTTTCCCATGTCACCACAGCAGAGTCTGGACCTGACCATCGGATTAGAACCTGCTCCACCATCTTAGCACCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.90% 4.20% 0.55% 5.29% NA
All Indica  2759 98.60% 0.30% 0.04% 1.05% NA
All Japonica  1512 86.80% 12.20% 0.93% 0.07% NA
Aus  269 21.60% 0.00% 3.72% 74.72% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 98.50% 0.40% 0.00% 1.08% NA
Indica III  913 99.10% 0.10% 0.00% 0.77% NA
Indica Intermediate  786 97.10% 0.60% 0.13% 2.16% NA
Temperate Japonica  767 97.00% 2.50% 0.52% 0.00% NA
Tropical Japonica  504 70.40% 28.00% 1.59% 0.00% NA
Japonica Intermediate  241 88.40% 10.40% 0.83% 0.41% NA
VI/Aromatic  96 84.40% 0.00% 0.00% 15.62% NA
Intermediate  90 86.70% 7.80% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1227225152 C -> DEL LOC_Os12g43850.1 N frameshift_variant Average:63.47; most accessible tissue: Callus, score: 82.671 N N N N
vg1227225152 C -> T LOC_Os12g43850.1 stop_gained ; p.Gln1559*; HIGH stop_gained Average:63.47; most accessible tissue: Callus, score: 82.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1227225152 NA 3.12E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227225152 NA 3.20E-07 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227225152 NA 1.23E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227225152 NA 1.76E-17 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227225152 NA 1.27E-13 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227225152 NA 1.75E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227225152 NA 3.44E-11 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227225152 NA 1.81E-06 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227225152 NA 3.20E-19 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227225152 NA 5.63E-07 mr1308_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227225152 NA 1.76E-13 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227225152 NA 6.11E-08 mr1860_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227225152 NA 1.99E-07 mr1905_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227225152 NA 2.07E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227225152 4.42E-07 6.12E-15 mr1993_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251