\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1227148815:

Variant ID: vg1227148815 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 27148815
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGATTGGACCGGATTTAATGGGAGGATCGGCTCCGTTATGGTACAGGCACGGTATTGTTCGAGCTGGGCCTACAGTTTCACTTGTGGGCTGAGCCGAA[G/A]
AGAGGTAGGCTGAGCAGAGGGAGGTAGCGGACATGGCTAGGACTGAAGCTGGAAAGGAAGGAATGAGCGTTCGATCCAAAACCAAGGAAGCATTCGGTCC

Reverse complement sequence

GGACCGAATGCTTCCTTGGTTTTGGATCGAACGCTCATTCCTTCCTTTCCAGCTTCAGTCCTAGCCATGTCCGCTACCTCCCTCTGCTCAGCCTACCTCT[C/T]
TTCGGCTCAGCCCACAAGTGAAACTGTAGGCCCAGCTCGAACAATACCGTGCCTGTACCATAACGGAGCCGATCCTCCCATTAAATCCGGTCCAATCTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.00% 24.50% 3.13% 2.35% NA
All Indica  2759 49.90% 40.90% 5.18% 3.99% NA
All Japonica  1512 99.50% 0.30% 0.13% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 69.60% 11.60% 12.27% 6.55% NA
Indica II  465 39.60% 53.10% 3.87% 3.44% NA
Indica III  913 43.60% 49.70% 3.18% 3.50% NA
Indica Intermediate  786 48.60% 45.50% 2.93% 2.93% NA
Temperate Japonica  767 99.70% 0.30% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 98.80% 0.40% 0.83% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 78.90% 16.70% 3.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1227148815 G -> DEL N N silent_mutation Average:52.722; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1227148815 G -> A LOC_Os12g43700.1 upstream_gene_variant ; 1164.0bp to feature; MODIFIER silent_mutation Average:52.722; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1227148815 G -> A LOC_Os12g43710.1 downstream_gene_variant ; 2107.0bp to feature; MODIFIER silent_mutation Average:52.722; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N
vg1227148815 G -> A LOC_Os12g43700-LOC_Os12g43710 intergenic_region ; MODIFIER silent_mutation Average:52.722; most accessible tissue: Zhenshan97 panicle, score: 65.386 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1227148815 NA 6.82E-08 mr1041_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 1.11E-06 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 1.60E-07 mr1293_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 3.43E-08 mr1294_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 7.60E-08 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 2.33E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 1.62E-06 mr1420_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 1.17E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 6.29E-07 mr1492_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 3.94E-06 mr1494_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 3.50E-10 mr1497_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 3.75E-07 mr1497_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 3.02E-07 mr1508_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 2.13E-09 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 2.20E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 6.51E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 8.07E-08 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 4.99E-06 mr1814_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 4.90E-07 mr1824_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227148815 NA 3.39E-08 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251