\
| Variant ID: vg1227115867 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 27115867 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 218. )
CTAAAAGTAATGAATTTTTAGGCCAAATGTTTATAATCATGAAATTTTGAGCAAAAGTCTAATAATCACGCTCTTTTATGACTAAGGCTAATCCTTTATG[G/A]
GTGTTTTTTAGCCAAAGCCTAAAATCAAGAATTTTTAGGCCAAAGGTTTAAAATCACGAAATTTTGGATAAAGTAATATTCAAACCTTTTTTTAGCCCAA
TTGGGCTAAAAAAAGGTTTGAATATTACTTTATCCAAAATTTCGTGATTTTAAACCTTTGGCCTAAAAATTCTTGATTTTAGGCTTTGGCTAAAAAACAC[C/T]
CATAAAGGATTAGCCTTAGTCATAAAAGAGCGTGATTATTAGACTTTTGCTCAAAATTTCATGATTATAAACATTTGGCCTAAAAATTCATTACTTTTAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.00% | 44.70% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 74.70% | 25.10% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 13.00% | 86.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 21.30% | 78.30% | 0.34% | 0.00% | NA |
| Indica II | 465 | 88.60% | 10.80% | 0.65% | 0.00% | NA |
| Indica III | 913 | 95.00% | 5.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 83.30% | 16.50% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 22.90% | 76.90% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 2.00% | 97.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 28.10% | 69.80% | 2.08% | 0.00% | NA |
| Intermediate | 90 | 51.10% | 45.60% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1227115867 | G -> A | LOC_Os12g43640.1 | downstream_gene_variant ; 3324.0bp to feature; MODIFIER | silent_mutation | Average:27.694; most accessible tissue: Callus, score: 58.716 | N | N | N | N |
| vg1227115867 | G -> A | LOC_Os12g43640-LOC_Os12g43660 | intergenic_region ; MODIFIER | silent_mutation | Average:27.694; most accessible tissue: Callus, score: 58.716 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1227115867 | NA | 5.35E-12 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227115867 | NA | 3.88E-06 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227115867 | NA | 3.65E-07 | mr1659 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227115867 | 1.89E-06 | 1.89E-06 | mr1074_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227115867 | NA | 6.96E-06 | mr1128_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227115867 | NA | 1.93E-13 | mr1170_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227115867 | NA | 2.77E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227115867 | NA | 4.20E-06 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227115867 | 8.08E-06 | 8.08E-06 | mr1256_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |