Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1227103163:

Variant ID: vg1227103163 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 27103163
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

TAACCAAACTAATTAAGAATATATATACTCGCTTGCTGGGATTATTCTTACACTAGTTCTTCCGAGGATGATCCCATGCATCGAATGTGTCAGTACTGTC[G/T]
CTCTCATACCAGCACACAAGCAACAATTTAGAATTTTAGATAATGGAATCAAACAACCAATTAATATGAAGCAAGTGTACTATAAAAAAATATAAGCATA

Reverse complement sequence

TATGCTTATATTTTTTTATAGTACACTTGCTTCATATTAATTGGTTGTTTGATTCCATTATCTAAAATTCTAAATTGTTGCTTGTGTGCTGGTATGAGAG[C/A]
GACAGTACTGACACATTCGATGCATGGGATCATCCTCGGAAGAACTAGTGTAAGAATAATCCCAGCAAGCGAGTATATATATTCTTAATTAGTTTGGTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.10%	22.10%	18.43%	2.39%	NA
All Indica	2759	43.50%	36.60%	18.52%	1.34%	NA
All Japonica	1512	72.60%	0.70%	21.83%	4.89%	NA
Aus	269	96.30%	3.70%	0.00%	0.00%	NA
Indica I	595	19.20%	13.10%	63.36%	4.37%	NA
Indica II	465	45.40%	49.00%	4.95%	0.65%	NA
Indica III	913	55.20%	42.60%	2.19%	0.00%	NA
Indica Intermediate	786	47.30%	40.10%	11.58%	1.02%	NA
Temperate Japonica	767	79.80%	0.50%	16.04%	3.65%	NA
Tropical Japonica	504	63.10%	1.00%	28.97%	6.94%	NA
Japonica Intermediate	241	69.30%	0.80%	25.31%	4.56%	NA
VI/Aromatic	96	88.50%	1.00%	9.38%	1.04%	NA
Intermediate	90	62.20%	13.30%	23.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1227103163	G -> DEL	N	N	silent_mutation	Average:62.962; most accessible tissue: Zhenshan97 root, score: 97.028	N	N	N	N
vg1227103163	G -> T	LOC_Os12g43630.1	upstream_gene_variant ; 3812.0bp to feature; MODIFIER	silent_mutation	Average:62.962; most accessible tissue: Zhenshan97 root, score: 97.028	N	N	N	N
vg1227103163	G -> T	LOC_Os12g43630.2	upstream_gene_variant ; 3812.0bp to feature; MODIFIER	silent_mutation	Average:62.962; most accessible tissue: Zhenshan97 root, score: 97.028	N	N	N	N
vg1227103163	G -> T	LOC_Os12g43630.3	upstream_gene_variant ; 3812.0bp to feature; MODIFIER	silent_mutation	Average:62.962; most accessible tissue: Zhenshan97 root, score: 97.028	N	N	N	N
vg1227103163	G -> T	LOC_Os12g43630-LOC_Os12g43640	intergenic_region ; MODIFIER	silent_mutation	Average:62.962; most accessible tissue: Zhenshan97 root, score: 97.028	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1227103163	G	T	-0.35	-0.34	-0.19	-0.03	-0.18	-0.2

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1227103163	NA	3.68E-06	mr1440	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163	3.10E-06	3.10E-06	mr1440	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163	NA	7.64E-06	mr1500	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163	NA	3.00E-06	mr1534	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163	NA	3.72E-09	mr1322_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163	NA	1.10E-08	mr1527_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163	8.59E-06	NA	mr1553_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163	NA	8.62E-06	mr1553_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163	NA	4.35E-09	mr1690_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163	NA	2.79E-07	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251