\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1227103163:

Variant ID: vg1227103163 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 27103163
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TAACCAAACTAATTAAGAATATATATACTCGCTTGCTGGGATTATTCTTACACTAGTTCTTCCGAGGATGATCCCATGCATCGAATGTGTCAGTACTGTC[G/T]
CTCTCATACCAGCACACAAGCAACAATTTAGAATTTTAGATAATGGAATCAAACAACCAATTAATATGAAGCAAGTGTACTATAAAAAAATATAAGCATA

Reverse complement sequence

TATGCTTATATTTTTTTATAGTACACTTGCTTCATATTAATTGGTTGTTTGATTCCATTATCTAAAATTCTAAATTGTTGCTTGTGTGCTGGTATGAGAG[C/A]
GACAGTACTGACACATTCGATGCATGGGATCATCCTCGGAAGAACTAGTGTAAGAATAATCCCAGCAAGCGAGTATATATATTCTTAATTAGTTTGGTTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.10% 22.10% 18.43% 2.39% NA
All Indica  2759 43.50% 36.60% 18.52% 1.34% NA
All Japonica  1512 72.60% 0.70% 21.83% 4.89% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 19.20% 13.10% 63.36% 4.37% NA
Indica II  465 45.40% 49.00% 4.95% 0.65% NA
Indica III  913 55.20% 42.60% 2.19% 0.00% NA
Indica Intermediate  786 47.30% 40.10% 11.58% 1.02% NA
Temperate Japonica  767 79.80% 0.50% 16.04% 3.65% NA
Tropical Japonica  504 63.10% 1.00% 28.97% 6.94% NA
Japonica Intermediate  241 69.30% 0.80% 25.31% 4.56% NA
VI/Aromatic  96 88.50% 1.00% 9.38% 1.04% NA
Intermediate  90 62.20% 13.30% 23.33% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1227103163 G -> DEL N N silent_mutation Average:62.962; most accessible tissue: Zhenshan97 root, score: 97.028 N N N N
vg1227103163 G -> T LOC_Os12g43630.1 upstream_gene_variant ; 3812.0bp to feature; MODIFIER silent_mutation Average:62.962; most accessible tissue: Zhenshan97 root, score: 97.028 N N N N
vg1227103163 G -> T LOC_Os12g43630.2 upstream_gene_variant ; 3812.0bp to feature; MODIFIER silent_mutation Average:62.962; most accessible tissue: Zhenshan97 root, score: 97.028 N N N N
vg1227103163 G -> T LOC_Os12g43630.3 upstream_gene_variant ; 3812.0bp to feature; MODIFIER silent_mutation Average:62.962; most accessible tissue: Zhenshan97 root, score: 97.028 N N N N
vg1227103163 G -> T LOC_Os12g43630-LOC_Os12g43640 intergenic_region ; MODIFIER silent_mutation Average:62.962; most accessible tissue: Zhenshan97 root, score: 97.028 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1227103163 G T -0.35 -0.34 -0.19 -0.03 -0.18 -0.2

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1227103163 NA 3.68E-06 mr1440 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163 3.10E-06 3.10E-06 mr1440 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163 NA 7.64E-06 mr1500 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163 NA 3.00E-06 mr1534 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163 NA 3.72E-09 mr1322_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163 NA 1.10E-08 mr1527_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163 8.59E-06 NA mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163 NA 8.62E-06 mr1553_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163 NA 4.35E-09 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227103163 NA 2.79E-07 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251