\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1227096317:

Variant ID: vg1227096317 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 27096317
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:


AACTTCAGCCAACAAACAACTCTGTAACCTCCATAGAAAAACATTTACCGTTAGACAGACTACTGTTAAACTTTCACCTAGCAAAAGCAAACGTAAGCAG[A/C]
AAAATCTAGAACATGGGAGGCCTTTATATTGATAAATGAAGAAAGGGGGATTTCGACACTTAAACATGCATTGAACTAGTAGTTTTCTGCCAACAACATG

Reverse complement sequence

CATGTTGTTGGCAGAAAACTACTAGTTCAATGCATGTTTAAGTGTCGAAATCCCCCTTTCTTCATTTATCAATATAAAGGCCTCCCATGTTCTAGATTTT[T/G]
CTGCTTACGTTTGCTTTTGCTAGGTGAAAGTTTAACAGTAGTCTGTCTAACGGTAAATGTTTTTCTATGGAGGTTACAGAGTTGTTTGTTGGCTGAAGTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.80% 44.60% 0.08% 0.53% NA
All Indica  2759 74.40% 24.90% 0.04% 0.62% NA
All Japonica  1512 12.70% 86.90% 0.20% 0.20% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 21.20% 78.00% 0.00% 0.84% NA
Indica II  465 88.60% 10.30% 0.00% 1.08% NA
Indica III  913 94.70% 5.00% 0.11% 0.11% NA
Indica Intermediate  786 82.80% 16.40% 0.00% 0.76% NA
Temperate Japonica  767 22.70% 76.90% 0.26% 0.13% NA
Tropical Japonica  504 1.60% 97.80% 0.20% 0.40% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 28.10% 69.80% 0.00% 2.08% NA
Intermediate  90 51.10% 45.60% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1227096317 A -> C LOC_Os12g43630.3 downstream_gene_variant ; 394.0bp to feature; MODIFIER silent_mutation Average:48.946; most accessible tissue: Callus, score: 80.801 N N N N
vg1227096317 A -> C LOC_Os12g43630.1 intron_variant ; MODIFIER silent_mutation Average:48.946; most accessible tissue: Callus, score: 80.801 N N N N
vg1227096317 A -> C LOC_Os12g43630.2 intron_variant ; MODIFIER silent_mutation Average:48.946; most accessible tissue: Callus, score: 80.801 N N N N
vg1227096317 A -> DEL N N silent_mutation Average:48.946; most accessible tissue: Callus, score: 80.801 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1227096317 NA 5.87E-13 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317 NA 8.19E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317 NA 1.78E-09 mr1322 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317 6.30E-06 6.30E-06 mr1074_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317 NA 6.29E-14 mr1170_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317 NA 1.38E-06 mr1170_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317 NA 7.45E-07 mr1184_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317 NA 1.55E-06 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317 NA 9.63E-06 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317 NA 6.95E-06 mr1779_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251