Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1227096317:

Variant ID: vg1227096317 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 27096317
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 268. )

Flanking Sequence (100 bp) in Reference Genome:

AACTTCAGCCAACAAACAACTCTGTAACCTCCATAGAAAAACATTTACCGTTAGACAGACTACTGTTAAACTTTCACCTAGCAAAAGCAAACGTAAGCAG[A/C]
AAAATCTAGAACATGGGAGGCCTTTATATTGATAAATGAAGAAAGGGGGATTTCGACACTTAAACATGCATTGAACTAGTAGTTTTCTGCCAACAACATG

Reverse complement sequence

CATGTTGTTGGCAGAAAACTACTAGTTCAATGCATGTTTAAGTGTCGAAATCCCCCTTTCTTCATTTATCAATATAAAGGCCTCCCATGTTCTAGATTTT[T/G]
CTGCTTACGTTTGCTTTTGCTAGGTGAAAGTTTAACAGTAGTCTGTCTAACGGTAAATGTTTTTCTATGGAGGTTACAGAGTTGTTTGTTGGCTGAAGTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.80%	44.60%	0.08%	0.53%	NA
All Indica	2759	74.40%	24.90%	0.04%	0.62%	NA
All Japonica	1512	12.70%	86.90%	0.20%	0.20%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	21.20%	78.00%	0.00%	0.84%	NA
Indica II	465	88.60%	10.30%	0.00%	1.08%	NA
Indica III	913	94.70%	5.00%	0.11%	0.11%	NA
Indica Intermediate	786	82.80%	16.40%	0.00%	0.76%	NA
Temperate Japonica	767	22.70%	76.90%	0.26%	0.13%	NA
Tropical Japonica	504	1.60%	97.80%	0.20%	0.40%	NA
Japonica Intermediate	241	4.10%	95.90%	0.00%	0.00%	NA
VI/Aromatic	96	28.10%	69.80%	0.00%	2.08%	NA
Intermediate	90	51.10%	45.60%	0.00%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1227096317	A -> C	LOC_Os12g43630.3	downstream_gene_variant ; 394.0bp to feature; MODIFIER	silent_mutation	Average:48.946; most accessible tissue: Callus, score: 80.801	N	N	N	N
vg1227096317	A -> C	LOC_Os12g43630.1	intron_variant ; MODIFIER	silent_mutation	Average:48.946; most accessible tissue: Callus, score: 80.801	N	N	N	N
vg1227096317	A -> C	LOC_Os12g43630.2	intron_variant ; MODIFIER	silent_mutation	Average:48.946; most accessible tissue: Callus, score: 80.801	N	N	N	N
vg1227096317	A -> DEL	N	N	silent_mutation	Average:48.946; most accessible tissue: Callus, score: 80.801	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1227096317	NA	5.87E-13	mr1170	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317	NA	8.19E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317	NA	1.78E-09	mr1322	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317	6.30E-06	6.30E-06	mr1074_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317	NA	6.29E-14	mr1170_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317	NA	1.38E-06	mr1170_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317	NA	7.45E-07	mr1184_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317	NA	1.55E-06	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317	NA	9.63E-06	mr1672_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1227096317	NA	6.95E-06	mr1779_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251