\
| Variant ID: vg1227096317 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 27096317 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 268. )
AACTTCAGCCAACAAACAACTCTGTAACCTCCATAGAAAAACATTTACCGTTAGACAGACTACTGTTAAACTTTCACCTAGCAAAAGCAAACGTAAGCAG[A/C]
AAAATCTAGAACATGGGAGGCCTTTATATTGATAAATGAAGAAAGGGGGATTTCGACACTTAAACATGCATTGAACTAGTAGTTTTCTGCCAACAACATG
CATGTTGTTGGCAGAAAACTACTAGTTCAATGCATGTTTAAGTGTCGAAATCCCCCTTTCTTCATTTATCAATATAAAGGCCTCCCATGTTCTAGATTTT[T/G]
CTGCTTACGTTTGCTTTTGCTAGGTGAAAGTTTAACAGTAGTCTGTCTAACGGTAAATGTTTTTCTATGGAGGTTACAGAGTTGTTTGTTGGCTGAAGTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.80% | 44.60% | 0.08% | 0.53% | NA |
| All Indica | 2759 | 74.40% | 24.90% | 0.04% | 0.62% | NA |
| All Japonica | 1512 | 12.70% | 86.90% | 0.20% | 0.20% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 21.20% | 78.00% | 0.00% | 0.84% | NA |
| Indica II | 465 | 88.60% | 10.30% | 0.00% | 1.08% | NA |
| Indica III | 913 | 94.70% | 5.00% | 0.11% | 0.11% | NA |
| Indica Intermediate | 786 | 82.80% | 16.40% | 0.00% | 0.76% | NA |
| Temperate Japonica | 767 | 22.70% | 76.90% | 0.26% | 0.13% | NA |
| Tropical Japonica | 504 | 1.60% | 97.80% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 4.10% | 95.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 28.10% | 69.80% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 51.10% | 45.60% | 0.00% | 3.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1227096317 | A -> C | LOC_Os12g43630.3 | downstream_gene_variant ; 394.0bp to feature; MODIFIER | silent_mutation | Average:48.946; most accessible tissue: Callus, score: 80.801 | N | N | N | N |
| vg1227096317 | A -> C | LOC_Os12g43630.1 | intron_variant ; MODIFIER | silent_mutation | Average:48.946; most accessible tissue: Callus, score: 80.801 | N | N | N | N |
| vg1227096317 | A -> C | LOC_Os12g43630.2 | intron_variant ; MODIFIER | silent_mutation | Average:48.946; most accessible tissue: Callus, score: 80.801 | N | N | N | N |
| vg1227096317 | A -> DEL | N | N | silent_mutation | Average:48.946; most accessible tissue: Callus, score: 80.801 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1227096317 | NA | 5.87E-13 | mr1170 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227096317 | NA | 8.19E-06 | mr1170 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227096317 | NA | 1.78E-09 | mr1322 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227096317 | 6.30E-06 | 6.30E-06 | mr1074_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227096317 | NA | 6.29E-14 | mr1170_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227096317 | NA | 1.38E-06 | mr1170_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227096317 | NA | 7.45E-07 | mr1184_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227096317 | NA | 1.55E-06 | mr1488_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227096317 | NA | 9.63E-06 | mr1672_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1227096317 | NA | 6.95E-06 | mr1779_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |