| Variant ID: vg1226987977 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 26987977 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 295. )
GGAATGATCTTGAGGTGCTTGTAGGATGGTGCTTTCAGTGAGAACTTTTCTTAGATGGATGTATATCTCTTCTTTATCAATGAAATGAGACAGAACTTCT[G/T]
CCTTTGTTTTTTTTTTAAAAAACTCTGGCTGTTAGGCTGGAGGGAATGAGGGAAAGACACAGGTAAGACAGTACAATCACCAAAAAAGTTAAAGGCACAA
TTGTGCCTTTAACTTTTTTGGTGATTGTACTGTCTTACCTGTGTCTTTCCCTCATTCCCTCCAGCCTAACAGCCAGAGTTTTTTAAAAAAAAAACAAAGG[C/A]
AGAAGTTCTGTCTCATTTCATTGATAAAGAAGAGATATACATCCATCTAAGAAAAGTTCTCACTGAAAGCACCATCCTACAAGCACCTCAAGATCATTCC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.70% | 3.90% | 3.43% | 0.00% | NA |
| All Indica | 2759 | 98.20% | 0.20% | 1.63% | 0.00% | NA |
| All Japonica | 1512 | 80.80% | 11.50% | 7.67% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 93.30% | 0.00% | 6.72% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.10% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 68.60% | 20.10% | 11.34% | 0.00% | NA |
| Tropical Japonica | 504 | 96.20% | 1.80% | 1.98% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 4.60% | 7.88% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 5.60% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1226987977 | G -> T | LOC_Os12g43500.1 | upstream_gene_variant ; 3169.0bp to feature; MODIFIER | silent_mutation | Average:53.889; most accessible tissue: Zhenshan97 root, score: 70.081 | N | N | N | N |
| vg1226987977 | G -> T | LOC_Os12g43510.1 | downstream_gene_variant ; 1679.0bp to feature; MODIFIER | silent_mutation | Average:53.889; most accessible tissue: Zhenshan97 root, score: 70.081 | N | N | N | N |
| vg1226987977 | G -> T | LOC_Os12g43510-LOC_Os12g43520 | intergenic_region ; MODIFIER | silent_mutation | Average:53.889; most accessible tissue: Zhenshan97 root, score: 70.081 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1226987977 | NA | 3.08E-08 | mr1026 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226987977 | NA | 6.17E-06 | mr1069 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226987977 | NA | 1.99E-07 | mr1161 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226987977 | NA | 8.16E-07 | mr1163 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226987977 | NA | 8.17E-06 | mr1180 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226987977 | NA | 1.92E-07 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226987977 | NA | 2.57E-07 | mr1183 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226987977 | NA | 9.53E-06 | mr1282 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226987977 | NA | 1.21E-07 | mr1503 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226987977 | NA | 1.25E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/