\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226987977:

Variant ID: vg1226987977 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 26987977
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


GGAATGATCTTGAGGTGCTTGTAGGATGGTGCTTTCAGTGAGAACTTTTCTTAGATGGATGTATATCTCTTCTTTATCAATGAAATGAGACAGAACTTCT[G/T]
CCTTTGTTTTTTTTTTAAAAAACTCTGGCTGTTAGGCTGGAGGGAATGAGGGAAAGACACAGGTAAGACAGTACAATCACCAAAAAAGTTAAAGGCACAA

Reverse complement sequence

TTGTGCCTTTAACTTTTTTGGTGATTGTACTGTCTTACCTGTGTCTTTCCCTCATTCCCTCCAGCCTAACAGCCAGAGTTTTTTAAAAAAAAAACAAAGG[C/A]
AGAAGTTCTGTCTCATTTCATTGATAAAGAAGAGATATACATCCATCTAAGAAAAGTTCTCACTGAAAGCACCATCCTACAAGCACCTCAAGATCATTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.70% 3.90% 3.43% 0.00% NA
All Indica  2759 98.20% 0.20% 1.63% 0.00% NA
All Japonica  1512 80.80% 11.50% 7.67% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 93.30% 0.00% 6.72% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.10% 0.64% 0.00% NA
Temperate Japonica  767 68.60% 20.10% 11.34% 0.00% NA
Tropical Japonica  504 96.20% 1.80% 1.98% 0.00% NA
Japonica Intermediate  241 87.60% 4.60% 7.88% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 93.30% 5.60% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1226987977 G -> T LOC_Os12g43500.1 upstream_gene_variant ; 3169.0bp to feature; MODIFIER silent_mutation Average:53.889; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg1226987977 G -> T LOC_Os12g43510.1 downstream_gene_variant ; 1679.0bp to feature; MODIFIER silent_mutation Average:53.889; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N
vg1226987977 G -> T LOC_Os12g43510-LOC_Os12g43520 intergenic_region ; MODIFIER silent_mutation Average:53.889; most accessible tissue: Zhenshan97 root, score: 70.081 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1226987977 NA 3.08E-08 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 NA 6.17E-06 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 NA 1.99E-07 mr1161 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 NA 8.16E-07 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 NA 8.17E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 NA 1.92E-07 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 NA 2.57E-07 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 NA 9.53E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 NA 1.21E-07 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 NA 1.25E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 NA 2.67E-07 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 NA 3.50E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 8.84E-06 6.63E-09 mr1161_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 NA 1.70E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 NA 6.82E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 NA 4.15E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 NA 1.48E-06 mr1441_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977 NA 3.07E-06 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251