Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226987977:

Variant ID: vg1226987977 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 26987977
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:

GGAATGATCTTGAGGTGCTTGTAGGATGGTGCTTTCAGTGAGAACTTTTCTTAGATGGATGTATATCTCTTCTTTATCAATGAAATGAGACAGAACTTCT[G/T]
CCTTTGTTTTTTTTTTAAAAAACTCTGGCTGTTAGGCTGGAGGGAATGAGGGAAAGACACAGGTAAGACAGTACAATCACCAAAAAAGTTAAAGGCACAA

Reverse complement sequence

TTGTGCCTTTAACTTTTTTGGTGATTGTACTGTCTTACCTGTGTCTTTCCCTCATTCCCTCCAGCCTAACAGCCAGAGTTTTTTAAAAAAAAAACAAAGG[C/A]
AGAAGTTCTGTCTCATTTCATTGATAAAGAAGAGATATACATCCATCTAAGAAAAGTTCTCACTGAAAGCACCATCCTACAAGCACCTCAAGATCATTCC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.70%	3.90%	3.43%	0.00%	NA
All Indica	2759	98.20%	0.20%	1.63%	0.00%	NA
All Japonica	1512	80.80%	11.50%	7.67%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	93.30%	0.00%	6.72%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.10%	0.64%	0.00%	NA
Temperate Japonica	767	68.60%	20.10%	11.34%	0.00%	NA
Tropical Japonica	504	96.20%	1.80%	1.98%	0.00%	NA
Japonica Intermediate	241	87.60%	4.60%	7.88%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	93.30%	5.60%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1226987977	G -> T	LOC_Os12g43500.1	upstream_gene_variant ; 3169.0bp to feature; MODIFIER	silent_mutation	Average:53.889; most accessible tissue: Zhenshan97 root, score: 70.081	N	N	N	N
vg1226987977	G -> T	LOC_Os12g43510.1	downstream_gene_variant ; 1679.0bp to feature; MODIFIER	silent_mutation	Average:53.889; most accessible tissue: Zhenshan97 root, score: 70.081	N	N	N	N
vg1226987977	G -> T	LOC_Os12g43510-LOC_Os12g43520	intergenic_region ; MODIFIER	silent_mutation	Average:53.889; most accessible tissue: Zhenshan97 root, score: 70.081	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1226987977	NA	3.08E-08	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	NA	6.17E-06	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	NA	1.99E-07	mr1161	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	NA	8.16E-07	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	NA	8.17E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	NA	1.92E-07	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	NA	2.57E-07	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	NA	9.53E-06	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	NA	1.21E-07	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	NA	1.25E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	NA	2.67E-07	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	NA	3.50E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	8.84E-06	6.63E-09	mr1161_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	NA	1.70E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	NA	6.82E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	NA	4.15E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	NA	1.48E-06	mr1441_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226987977	NA	3.07E-06	mr1627_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251