Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226954152:

Variant ID: vg1226954152 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 26954152
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACATATAAGTATATTTAACAATGAATTAAATGATAGGAAAGAATTAATAATTACTTAATTTTTTTGAATAAGATAAACGGTCAAACATATTTAGGAAAAT[C/T]
AACGGCGTCAAACATTTAAAAAAACGGAGGGAGTATGATCTGGCCGGCTAGACGATCTCATATCTCTATATATGCATGTAGAAGTCAAGTTTAGCTCCAT

Reverse complement sequence

ATGGAGCTAAACTTGACTTCTACATGCATATATAGAGATATGAGATCGTCTAGCCGGCCAGATCATACTCCCTCCGTTTTTTTAAATGTTTGACGCCGTT[G/A]
ATTTTCCTAAATATGTTTGACCGTTTATCTTATTCAAAAAAATTAAGTAATTATTAATTCTTTCCTATCATTTAATTCATTGTTAAATATACTTATATGT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.20%	12.80%	0.23%	39.78%	NA
All Indica	2759	78.10%	3.30%	0.11%	18.48%	NA
All Japonica	1512	1.60%	14.70%	0.40%	83.33%	NA
Aus	269	3.00%	94.80%	0.37%	1.86%	NA
Indica I	595	37.60%	7.40%	0.34%	54.62%	NA
Indica II	465	94.20%	1.10%	0.00%	4.73%	NA
Indica III	913	91.80%	1.20%	0.11%	6.90%	NA
Indica Intermediate	786	83.30%	3.90%	0.00%	12.72%	NA
Temperate Japonica	767	1.00%	26.30%	0.65%	71.97%	NA
Tropical Japonica	504	2.00%	1.60%	0.20%	96.23%	NA
Japonica Intermediate	241	2.50%	5.00%	0.00%	92.53%	NA
VI/Aromatic	96	3.10%	18.80%	1.04%	77.08%	NA
Intermediate	90	46.70%	18.90%	0.00%	34.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1226954152	C -> DEL	N	N	silent_mutation	Average:50.682; most accessible tissue: Minghui63 root, score: 86.253	N	N	N	N
vg1226954152	C -> T	LOC_Os12g43440.1	downstream_gene_variant ; 1990.0bp to feature; MODIFIER	silent_mutation	Average:50.682; most accessible tissue: Minghui63 root, score: 86.253	N	N	N	N
vg1226954152	C -> T	LOC_Os12g43410-LOC_Os12g43440	intergenic_region ; MODIFIER	silent_mutation	Average:50.682; most accessible tissue: Minghui63 root, score: 86.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1226954152	NA	2.19E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	1.72E-14	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	3.90E-27	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	3.18E-20	mr1244	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	3.76E-15	mr1270	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	2.31E-32	mr1305	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	9.38E-07	mr1321	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	2.60E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	8.15E-09	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	5.10E-17	mr1409	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	6.54E-12	mr1540	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	4.60E-09	mr1585	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	5.15E-34	mr1586	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	2.55E-15	mr1649	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	8.55E-07	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	8.73E-18	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	3.03E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	2.28E-13	mr1409_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	6.47E-09	mr1510_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	4.36E-14	mr1583_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	3.76E-10	mr1649_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	6.64E-06	NA	mr1672_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	5.46E-06	mr1672_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	2.17E-08	mr1707_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152	NA	5.13E-06	mr1740_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251