\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226954152:

Variant ID: vg1226954152 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 26954152
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATATAAGTATATTTAACAATGAATTAAATGATAGGAAAGAATTAATAATTACTTAATTTTTTTGAATAAGATAAACGGTCAAACATATTTAGGAAAAT[C/T]
AACGGCGTCAAACATTTAAAAAAACGGAGGGAGTATGATCTGGCCGGCTAGACGATCTCATATCTCTATATATGCATGTAGAAGTCAAGTTTAGCTCCAT

Reverse complement sequence

ATGGAGCTAAACTTGACTTCTACATGCATATATAGAGATATGAGATCGTCTAGCCGGCCAGATCATACTCCCTCCGTTTTTTTAAATGTTTGACGCCGTT[G/A]
ATTTTCCTAAATATGTTTGACCGTTTATCTTATTCAAAAAAATTAAGTAATTATTAATTCTTTCCTATCATTTAATTCATTGTTAAATATACTTATATGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.20% 12.80% 0.23% 39.78% NA
All Indica  2759 78.10% 3.30% 0.11% 18.48% NA
All Japonica  1512 1.60% 14.70% 0.40% 83.33% NA
Aus  269 3.00% 94.80% 0.37% 1.86% NA
Indica I  595 37.60% 7.40% 0.34% 54.62% NA
Indica II  465 94.20% 1.10% 0.00% 4.73% NA
Indica III  913 91.80% 1.20% 0.11% 6.90% NA
Indica Intermediate  786 83.30% 3.90% 0.00% 12.72% NA
Temperate Japonica  767 1.00% 26.30% 0.65% 71.97% NA
Tropical Japonica  504 2.00% 1.60% 0.20% 96.23% NA
Japonica Intermediate  241 2.50% 5.00% 0.00% 92.53% NA
VI/Aromatic  96 3.10% 18.80% 1.04% 77.08% NA
Intermediate  90 46.70% 18.90% 0.00% 34.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1226954152 C -> DEL N N silent_mutation Average:50.682; most accessible tissue: Minghui63 root, score: 86.253 N N N N
vg1226954152 C -> T LOC_Os12g43440.1 downstream_gene_variant ; 1990.0bp to feature; MODIFIER silent_mutation Average:50.682; most accessible tissue: Minghui63 root, score: 86.253 N N N N
vg1226954152 C -> T LOC_Os12g43410-LOC_Os12g43440 intergenic_region ; MODIFIER silent_mutation Average:50.682; most accessible tissue: Minghui63 root, score: 86.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1226954152 NA 2.19E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 1.72E-14 mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 3.90E-27 mr1210 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 3.18E-20 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 3.76E-15 mr1270 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 2.31E-32 mr1305 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 9.38E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 2.60E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 8.15E-09 mr1403 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 5.10E-17 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 6.54E-12 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 4.60E-09 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 5.15E-34 mr1586 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 2.55E-15 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 8.55E-07 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 8.73E-18 mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 3.03E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 2.28E-13 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 6.47E-09 mr1510_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 4.36E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 3.76E-10 mr1649_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 6.64E-06 NA mr1672_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 5.46E-06 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 2.17E-08 mr1707_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226954152 NA 5.13E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251