Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226948201:

Variant ID: vg1226948201 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 26948201
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGCACATGTGATTATTAGATTTCTATATATTTGAAAGTATTTTTATATGATATTGATTTTATAGTCATTTATAATATATTATAAAACAAATTAATGTTT[A/G]
AAGTATATGTAAAATAATACTTATCTTATTTTAGGATGAAGGGAATATACTTTATATGCACGAGTGTTTGACCTTGAAAAGTACGTATACACATAATATT

Reverse complement sequence

AATATTATGTGTATACGTACTTTTCAAGGTCAAACACTCGTGCATATAAAGTATATTCCCTTCATCCTAAAATAAGATAAGTATTATTTTACATATACTT[T/C]
AAACATTAATTTGTTTTATAATATATTATAAATGACTATAAAATCAATATCATATAAAAATACTTTCAAATATATAGAAATCTAATAATCACATGTGCAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.00%	16.70%	8.57%	14.81%	NA
All Indica	2759	81.30%	8.60%	4.60%	5.51%	NA
All Japonica	1512	16.30%	33.00%	17.20%	33.53%	NA
Aus	269	97.80%	1.10%	0.37%	0.74%	NA
Indica I	595	44.40%	25.40%	16.13%	14.12%	NA
Indica II	465	95.30%	2.20%	0.65%	1.94%	NA
Indica III	913	93.10%	3.30%	0.99%	2.63%	NA
Indica Intermediate	786	87.30%	5.90%	2.42%	4.45%	NA
Temperate Japonica	767	27.40%	25.00%	17.60%	29.99%	NA
Tropical Japonica	504	3.80%	43.70%	15.48%	37.10%	NA
Japonica Intermediate	241	7.10%	36.10%	19.50%	37.34%	NA
VI/Aromatic	96	24.00%	33.30%	10.42%	32.29%	NA
Intermediate	90	65.60%	17.80%	7.78%	8.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1226948201	A -> DEL	N	N	silent_mutation	Average:32.359; most accessible tissue: Minghui63 root, score: 73.351	N	N	N	N
vg1226948201	A -> G	LOC_Os12g43410-LOC_Os12g43440	intergenic_region ; MODIFIER	silent_mutation	Average:32.359; most accessible tissue: Minghui63 root, score: 73.351	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1226948201	NA	1.26E-14	mr1062	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226948201	NA	1.83E-07	mr1201	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226948201	NA	3.14E-06	mr1219	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226948201	NA	1.71E-08	mr1274	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226948201	NA	7.56E-11	mr1332	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226948201	NA	1.26E-09	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226948201	NA	1.59E-07	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226948201	NA	2.67E-08	mr1662	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226948201	NA	3.05E-06	mr1128_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226948201	7.82E-06	1.09E-06	mr1152_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226948201	5.74E-07	1.38E-07	mr1154_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226948201	NA	7.27E-09	mr1170_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226948201	NA	6.13E-06	mr1201_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226948201	NA	8.71E-06	mr1662_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226948201	NA	1.01E-06	mr1745_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251