\
| Variant ID: vg1226936545 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 26936545 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TATCATAAATATTTAAATAACACATCGAAAATAAGATGACGTCCCTCGATGGGTAAAATGACTTTTGTCCTGAGCATACTATTCTTCGCGGGGAGACCGC[G/A]
CCAAGCTGGTCATCGTGCACACAAGCATACTATATCATTGTCATCTCTGCTGCTTCTATCGATCTTTTATTATTTGTGTATCCATGCATGCTAGGGACTG
CAGTCCCTAGCATGCATGGATACACAAATAATAAAAGATCGATAGAAGCAGCAGAGATGACAATGATATAGTATGCTTGTGTGCACGATGACCAGCTTGG[C/T]
GCGGTCTCCCCGCGAAGAATAGTATGCTCAGGACAAAAGTCATTTTACCCATCGAGGGACGTCATCTTATTTTCGATGTGTTATTTAAATATTTATGATA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.30% | 12.40% | 0.91% | 39.31% | NA |
| All Indica | 2759 | 78.30% | 3.00% | 0.43% | 18.30% | NA |
| All Japonica | 1512 | 1.90% | 14.00% | 1.59% | 82.61% | NA |
| Aus | 269 | 1.10% | 96.70% | 0.00% | 2.23% | NA |
| Indica I | 595 | 37.80% | 5.70% | 1.51% | 54.96% | NA |
| Indica II | 465 | 94.40% | 1.10% | 0.00% | 4.52% | NA |
| Indica III | 913 | 91.90% | 1.20% | 0.11% | 6.79% | NA |
| Indica Intermediate | 786 | 83.50% | 4.20% | 0.25% | 12.09% | NA |
| Temperate Japonica | 767 | 1.60% | 25.70% | 2.35% | 70.40% | NA |
| Tropical Japonica | 504 | 2.00% | 1.40% | 0.79% | 95.83% | NA |
| Japonica Intermediate | 241 | 2.50% | 2.90% | 0.83% | 93.78% | NA |
| VI/Aromatic | 96 | 4.20% | 19.80% | 4.17% | 71.88% | NA |
| Intermediate | 90 | 47.80% | 16.70% | 3.33% | 32.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1226936545 | G -> DEL | N | N | silent_mutation | Average:35.716; most accessible tissue: Callus, score: 79.837 | N | N | N | N |
| vg1226936545 | G -> A | LOC_Os12g43410.1 | upstream_gene_variant ; 3253.0bp to feature; MODIFIER | silent_mutation | Average:35.716; most accessible tissue: Callus, score: 79.837 | N | N | N | N |
| vg1226936545 | G -> A | LOC_Os12g43410-LOC_Os12g43440 | intergenic_region ; MODIFIER | silent_mutation | Average:35.716; most accessible tissue: Callus, score: 79.837 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1226936545 | NA | 3.69E-06 | mr1662 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | NA | 1.26E-06 | mr1041_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | NA | 8.07E-06 | mr1050_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | NA | 4.23E-06 | mr1245_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | NA | 1.61E-06 | mr1293_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | NA | 4.78E-06 | mr1373_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | NA | 1.25E-06 | mr1373_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | NA | 3.38E-06 | mr1497_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | NA | 8.13E-07 | mr1508_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | NA | 9.84E-06 | mr1508_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | NA | 4.29E-06 | mr1543_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | NA | 5.97E-06 | mr1655_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | NA | 6.48E-08 | mr1662_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | 6.31E-06 | 6.31E-06 | mr1697_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | NA | 4.24E-07 | mr1745_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | 2.24E-06 | 2.24E-06 | mr1832_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | 1.31E-06 | 1.30E-06 | mr1833_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | 1.76E-06 | 1.76E-06 | mr1843_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226936545 | NA | 4.80E-10 | mr1851_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |