\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226927430:

Variant ID: vg1226927430 (JBrowse)Variation Type: INDEL
Chromosome: chr12Position: 26927430
Reference Allele: CAlternative Allele: T,CGGTGGT
Primary Allele: TSecondary Allele: CGGTGGT

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGTGATGGTGAGGCGAGGGCGCACCTTGCTCGTGCTGCTCGTGGTCGTTTTCCTTGTCGTCATGGAGGCAGCGGCGCGACCCCTCCTTGGGCGGCGGCGG[C/T,CGGTGGT]
GGTGCGGCTCCCCTACCCTTCCTCTCCCTCTCCCGCCCAGTTCTGGCGGAGGGGCGACGATGGCGCGGCCGAAGAGGGGAGGGCGGTGGTGGGTAGGGGT

Reverse complement sequence

ACCCCTACCCACCACCGCCCTCCCCTCTTCGGCCGCGCCATCGTCGCCCCTCCGCCAGAACTGGGCGGGAGAGGGAGAGGAAGGGTAGGGGAGCCGCACC[G/A,ACCACCG]
CCGCCGCCGCCCAAGGAGGGGTCGCGCCGCTGCCTCCATGACGACAAGGAAAACGACCACGAGCAGCACGAGCAAGGTGCGCCCTCGCCTCACCATCACC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of CGGTGGT(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.90% 6.10% 0.63% 39.78% C: 5.54%
All Indica  2759 78.70% 0.90% 0.33% 18.63% C: 1.45%
All Japonica  1512 1.90% 0.00% 1.06% 83.33% C: 13.69%
Aus  269 5.20% 88.80% 0.37% 2.23% C: 3.35%
Indica I  595 37.60% 0.20% 0.84% 56.13% C: 5.21%
Indica II  465 95.30% 0.00% 0.43% 4.30% NA
Indica III  913 91.90% 1.00% 0.11% 6.79% C: 0.22%
Indica Intermediate  786 84.60% 1.90% 0.13% 12.47% C: 0.89%
Temperate Japonica  767 1.70% 0.00% 1.69% 71.45% C: 25.16%
Tropical Japonica  504 2.00% 0.00% 0.60% 96.03% C: 1.39%
Japonica Intermediate  241 2.50% 0.00% 0.00% 94.61% C: 2.90%
VI/Aromatic  96 3.10% 18.80% 4.17% 72.92% C: 1.04%
Intermediate  90 52.20% 8.90% 0.00% 33.33% C: 5.56%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1226927430 C -> DEL N N silent_mutation Average:50.277; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg1226927430 C -> CGGTGGT LOC_Os12g43430.1 upstream_gene_variant ; 4670.0bp to feature; MODIFIER silent_mutation Average:50.277; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg1226927430 C -> CGGTGGT LOC_Os12g43390.1 upstream_gene_variant ; 4732.0bp to feature; MODIFIER silent_mutation Average:50.277; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg1226927430 C -> CGGTGGT LOC_Os12g43400.1 downstream_gene_variant ; 2734.0bp to feature; MODIFIER silent_mutation Average:50.277; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg1226927430 C -> CGGTGGT LOC_Os12g43410.1 downstream_gene_variant ; 4842.0bp to feature; MODIFIER silent_mutation Average:50.277; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg1226927430 C -> CGGTGGT LOC_Os12g43400-LOC_Os12g43410 intergenic_region ; MODIFIER silent_mutation Average:50.277; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg1226927430 C -> T LOC_Os12g43430.1 upstream_gene_variant ; 4669.0bp to feature; MODIFIER silent_mutation Average:50.277; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg1226927430 C -> T LOC_Os12g43390.1 upstream_gene_variant ; 4731.0bp to feature; MODIFIER silent_mutation Average:50.277; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg1226927430 C -> T LOC_Os12g43400.1 downstream_gene_variant ; 2733.0bp to feature; MODIFIER silent_mutation Average:50.277; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg1226927430 C -> T LOC_Os12g43410.1 downstream_gene_variant ; 4843.0bp to feature; MODIFIER silent_mutation Average:50.277; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N
vg1226927430 C -> T LOC_Os12g43400-LOC_Os12g43410 intergenic_region ; MODIFIER silent_mutation Average:50.277; most accessible tissue: Minghui63 young leaf, score: 86.378 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1226927430 C CGGTG* 0.02 -0.07 -0.05 -0.02 -0.04 -0.01
vg1226927430 C T -0.01 -0.02 -0.01 -0.02 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1226927430 4.10E-06 4.10E-06 mr1074_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226927430 5.65E-06 5.65E-06 mr1081_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226927430 7.77E-06 NA mr1092_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226927430 1.32E-07 NA mr1128_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226927430 3.75E-06 7.88E-07 mr1128_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226927430 8.07E-06 NA mr1152_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226927430 3.85E-06 NA mr1154_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226927430 6.13E-06 1.46E-06 mr1154_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226927430 5.65E-06 NA mr1204_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226927430 3.71E-06 3.71E-06 mr1256_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226927430 NA 7.47E-06 mr1344_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226927430 NA 1.97E-06 mr1743_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251