\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226907992:

Variant ID: vg1226907992 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 26907992
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 286. )

Flanking Sequence (100 bp) in Reference Genome:


CAACTAGTGAGGAAAAGAGGGAACTGGAGCGGCTACAAAAGCCGATGTACAATGCTGTTCGCCGAGCAGCAGAAGTTCATAGACAGGTACATAATACACT[G/A]
GCCTTTTTCATTGTTTGTGGTCTCTTTCATTGTTTGCAGCTATGTTTTGAATCTGTCTGTTTGTTACAACTCCTTAATATATTTTCTAGGTCCGGAAGCA

Reverse complement sequence

TGCTTCCGGACCTAGAAAATATATTAAGGAGTTGTAACAAACAGACAGATTCAAAACATAGCTGCAAACAATGAAAGAGACCACAAACAATGAAAAAGGC[C/T]
AGTGTATTATGTACCTGTCTATGAACTTCTGCTGCTCGGCGAACAGCATTGTACATCGGCTTTTGTAGCCGCTCCAGTTCCCTCTTTTCCTCACTAGTTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.60% 2.80% 1.59% 0.00% NA
All Indica  2759 98.90% 0.30% 0.76% 0.00% NA
All Japonica  1512 88.60% 7.90% 3.51% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.80% 0.00% 3.19% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.60% 0.25% 0.00% NA
Temperate Japonica  767 82.10% 12.00% 5.87% 0.00% NA
Tropical Japonica  504 96.40% 2.40% 1.19% 0.00% NA
Japonica Intermediate  241 92.50% 6.60% 0.83% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 4.40% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1226907992 G -> A LOC_Os12g43363.1 downstream_gene_variant ; 2067.0bp to feature; MODIFIER silent_mutation Average:52.766; most accessible tissue: Callus, score: 75.094 N N N N
vg1226907992 G -> A LOC_Os12g43380.1 downstream_gene_variant ; 4982.0bp to feature; MODIFIER silent_mutation Average:52.766; most accessible tissue: Callus, score: 75.094 N N N N
vg1226907992 G -> A LOC_Os12g43363.2 downstream_gene_variant ; 2067.0bp to feature; MODIFIER silent_mutation Average:52.766; most accessible tissue: Callus, score: 75.094 N N N N
vg1226907992 G -> A LOC_Os12g43363.3 downstream_gene_variant ; 2067.0bp to feature; MODIFIER silent_mutation Average:52.766; most accessible tissue: Callus, score: 75.094 N N N N
vg1226907992 G -> A LOC_Os12g43370.1 intron_variant ; MODIFIER silent_mutation Average:52.766; most accessible tissue: Callus, score: 75.094 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1226907992 NA 5.79E-07 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226907992 NA 5.19E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226907992 2.06E-06 NA mr1588_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226907992 NA 5.16E-08 mr1588_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251