\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226817020:

Variant ID: vg1226817020 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 26817020
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGGCCGATGAGGTAAGTATCCTATTTTCCTAACTAGCCCTTTTTGGTTTTATCCCGTTAAGGGAGTTGTTTTGATTGTGAACTTTGTTTTGCAAGCATG[G/A]
TGGAATAAACTCATTCATAACACAACAGTAATAATATCATAAATAACATCACAGAGTTCCGCAGATAGTACATAAATCATGATGCAATCGACTGCACATA

Reverse complement sequence

TATGTGCAGTCGATTGCATCATGATTTATGTACTATCTGCGGAACTCTGTGATGTTATTTATGATATTATTACTGTTGTGTTATGAATGAGTTTATTCCA[C/T]
CATGCTTGCAAAACAAAGTTCACAATCAAAACAACTCCCTTAACGGGATAAAACCAAAAAGGGCTAGTTAGGAAAATAGGATACTTACCTCATCGGCCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.20% 4.80% 21.84% 23.19% NA
All Indica  2759 32.50% 0.50% 29.36% 37.59% NA
All Japonica  1512 79.00% 13.60% 7.28% 0.13% NA
Aus  269 51.70% 0.00% 36.43% 11.90% NA
Indica I  595 63.50% 1.00% 17.65% 17.82% NA
Indica II  465 19.40% 1.70% 25.16% 53.76% NA
Indica III  913 21.80% 0.00% 37.90% 40.31% NA
Indica Intermediate  786 29.30% 0.10% 30.79% 39.82% NA
Temperate Japonica  767 63.90% 24.40% 11.73% 0.00% NA
Tropical Japonica  504 95.40% 2.00% 2.58% 0.00% NA
Japonica Intermediate  241 92.50% 3.70% 2.90% 0.83% NA
VI/Aromatic  96 90.60% 0.00% 2.08% 7.29% NA
Intermediate  90 60.00% 6.70% 13.33% 20.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1226817020 G -> DEL N N silent_mutation Average:25.272; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg1226817020 G -> A LOC_Os12g43200.1 upstream_gene_variant ; 3802.0bp to feature; MODIFIER silent_mutation Average:25.272; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg1226817020 G -> A LOC_Os12g43220.1 downstream_gene_variant ; 4709.0bp to feature; MODIFIER silent_mutation Average:25.272; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg1226817020 G -> A LOC_Os12g43179.1 intron_variant ; MODIFIER silent_mutation Average:25.272; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1226817020 NA 1.33E-08 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 6.19E-07 mr1069 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 6.27E-08 mr1161 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 8.32E-09 mr1163 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 2.10E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 6.26E-06 3.73E-13 mr1182 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 7.59E-07 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 1.57E-08 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 7.37E-07 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 1.60E-06 mr1482 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 6.37E-09 mr1503 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 6.24E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 1.51E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 3.08E-07 5.58E-14 mr1650 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 3.04E-07 mr1650 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 6.50E-09 mr1658 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 1.35E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 1.50E-06 mr1063_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 1.83E-08 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 1.71E-07 mr1180_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 7.67E-13 mr1182_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 2.76E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 4.06E-07 mr1183_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020 NA 3.19E-06 mr1441_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251