Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226817020:

Variant ID: vg1226817020 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 26817020
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAGGCCGATGAGGTAAGTATCCTATTTTCCTAACTAGCCCTTTTTGGTTTTATCCCGTTAAGGGAGTTGTTTTGATTGTGAACTTTGTTTTGCAAGCATG[G/A]
TGGAATAAACTCATTCATAACACAACAGTAATAATATCATAAATAACATCACAGAGTTCCGCAGATAGTACATAAATCATGATGCAATCGACTGCACATA

Reverse complement sequence

TATGTGCAGTCGATTGCATCATGATTTATGTACTATCTGCGGAACTCTGTGATGTTATTTATGATATTATTACTGTTGTGTTATGAATGAGTTTATTCCA[C/T]
CATGCTTGCAAAACAAAGTTCACAATCAAAACAACTCCCTTAACGGGATAAAACCAAAAAGGGCTAGTTAGGAAAATAGGATACTTACCTCATCGGCCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.20%	4.80%	21.84%	23.19%	NA
All Indica	2759	32.50%	0.50%	29.36%	37.59%	NA
All Japonica	1512	79.00%	13.60%	7.28%	0.13%	NA
Aus	269	51.70%	0.00%	36.43%	11.90%	NA
Indica I	595	63.50%	1.00%	17.65%	17.82%	NA
Indica II	465	19.40%	1.70%	25.16%	53.76%	NA
Indica III	913	21.80%	0.00%	37.90%	40.31%	NA
Indica Intermediate	786	29.30%	0.10%	30.79%	39.82%	NA
Temperate Japonica	767	63.90%	24.40%	11.73%	0.00%	NA
Tropical Japonica	504	95.40%	2.00%	2.58%	0.00%	NA
Japonica Intermediate	241	92.50%	3.70%	2.90%	0.83%	NA
VI/Aromatic	96	90.60%	0.00%	2.08%	7.29%	NA
Intermediate	90	60.00%	6.70%	13.33%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1226817020	G -> DEL	N	N	silent_mutation	Average:25.272; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg1226817020	G -> A	LOC_Os12g43200.1	upstream_gene_variant ; 3802.0bp to feature; MODIFIER	silent_mutation	Average:25.272; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg1226817020	G -> A	LOC_Os12g43220.1	downstream_gene_variant ; 4709.0bp to feature; MODIFIER	silent_mutation	Average:25.272; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N
vg1226817020	G -> A	LOC_Os12g43179.1	intron_variant ; MODIFIER	silent_mutation	Average:25.272; most accessible tissue: Zhenshan97 flag leaf, score: 65.82	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1226817020	NA	1.33E-08	mr1026	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	6.19E-07	mr1069	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	6.27E-08	mr1161	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	8.32E-09	mr1163	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	2.10E-06	mr1180	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	6.26E-06	3.73E-13	mr1182	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	7.59E-07	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	1.57E-08	mr1183	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	7.37E-07	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	1.60E-06	mr1482	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	6.37E-09	mr1503	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	6.24E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	1.51E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	3.08E-07	5.58E-14	mr1650	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	3.04E-07	mr1650	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	6.50E-09	mr1658	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	1.35E-06	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	1.50E-06	mr1063_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	1.83E-08	mr1161_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	1.71E-07	mr1180_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	7.67E-13	mr1182_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	2.76E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	4.06E-07	mr1183_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226817020	NA	3.19E-06	mr1441_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251