\
| Variant ID: vg1226816492 (JBrowse) | Variation Type: SNP |
| Chromosome: chr12 | Position: 26816492 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 100. )
CTGCGAGGTCTCCGATTGCGTAGCGGGCCAACTGAGTGAACCGGTTCAGATATTCTTGCACCGTTGTGTTTCCTTGTCGCAGCCTTCTGAACTCGTTCTT[C/G]
TTCATGCGCATCACCGCGGCAGGCACGAAGTTCTCACGAAAAGCTGCAGTGAATTCTTCCCAAGTGGGTTCTCCAGCATCTTCTTCTCGAGCTTCCTTGT
ACAAGGAAGCTCGAGAAGAAGATGCTGGAGAACCCACTTGGGAAGAATTCACTGCAGCTTTTCGTGAGAACTTCGTGCCTGCCGCGGTGATGCGCATGAA[G/C]
AAGAACGAGTTCAGAAGGCTGCGACAAGGAAACACAACGGTGCAAGAATATCTGAACCGGTTCACTCAGTTGGCCCGCTACGCAATCGGAGACCTCGCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.20% | 9.80% | 0.97% | 0.06% | NA |
| All Indica | 2759 | 89.50% | 9.50% | 0.87% | 0.11% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 20.40% | 71.70% | 7.81% | 0.00% | NA |
| Indica I | 595 | 96.50% | 3.00% | 0.50% | 0.00% | NA |
| Indica II | 465 | 81.70% | 17.00% | 1.29% | 0.00% | NA |
| Indica III | 913 | 92.20% | 7.00% | 0.44% | 0.33% | NA |
| Indica Intermediate | 786 | 85.60% | 13.00% | 1.40% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 4.20% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 3.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1226816492 | C -> DEL | LOC_Os12g43179.1 | N | frameshift_variant | Average:47.901; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 | N | N | N | N |
| vg1226816492 | C -> G | LOC_Os12g43179.1 | missense_variant ; p.Lys378Asn; MODERATE | nonsynonymous_codon ; K378N | Average:47.901; most accessible tissue: Zhenshan97 flag leaf, score: 81.605 | unknown | unknown | DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1226816492 | NA | 5.93E-14 | mr1317 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 2.55E-09 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 1.11E-08 | mr1608 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 6.12E-06 | mr1649 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 6.52E-06 | mr1818 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | 2.98E-08 | 7.06E-47 | mr1855 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | 2.32E-06 | 1.23E-20 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 8.52E-13 | mr1897 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 1.08E-11 | mr1927 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 2.59E-16 | mr1317_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 5.12E-11 | mr1317_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 3.72E-09 | mr1608_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 2.84E-06 | mr1608_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 3.00E-13 | mr1610_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 4.29E-07 | mr1610_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | 6.38E-06 | 1.29E-19 | mr1818_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 1.78E-10 | mr1818_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | 1.76E-09 | 1.01E-51 | mr1855_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | 1.64E-07 | 1.91E-20 | mr1855_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 3.22E-15 | mr1897_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 7.48E-07 | mr1897_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 1.67E-19 | mr1914_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 2.51E-12 | mr1914_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 1.92E-22 | mr1927_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1226816492 | NA | 1.88E-10 | mr1927_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |