Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226816132:

Variant ID: vg1226816132 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 26816132
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGCAGTTGAAGCAGTCCACATTCTTCTTGACTCCAGGGGCAGCCAGGGTTGGTGTAGGGGTGCGGTTCTGAACCGCAACTGGCCTATTGAAATTGCTAGG[C/T]
GCAGCGGGACGGTTGGTTGCCACAATAGTGGGCTTCCGTCCAGACGAAGTGGCCCCCTTGAGTCGCTGAGGTACTCCCTGAGGCGGGCGATTCATAGCAA

Reverse complement sequence

TTGCTATGAATCGCCCGCCTCAGGGAGTACCTCAGCGACTCAAGGGGGCCACTTCGTCTGGACGGAAGCCCACTATTGTGGCAACCAACCGTCCCGCTGC[G/A]
CCTAGCAATTTCAATAGGCCAGTTGCGGTTCAGAACCGCACCCCTACACCAACCCTGGCTGCCCCTGGAGTCAAGAAGAATGTGGACTGCTTCAACTGCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	50.00%	45.50%	3.07%	1.35%	NA
All Indica	2759	28.10%	67.60%	4.06%	0.29%	NA
All Japonica	1512	94.50%	0.20%	1.85%	3.44%	NA
Aus	269	9.30%	90.70%	0.00%	0.00%	NA
Indica I	595	68.90%	27.90%	3.03%	0.17%	NA
Indica II	465	14.60%	77.20%	7.31%	0.86%	NA
Indica III	913	12.60%	84.40%	2.85%	0.11%	NA
Indica Intermediate	786	23.20%	72.30%	4.33%	0.25%	NA
Temperate Japonica	767	98.40%	0.00%	0.00%	1.56%	NA
Tropical Japonica	504	87.50%	0.40%	4.56%	7.54%	NA
Japonica Intermediate	241	96.70%	0.40%	2.07%	0.83%	NA
VI/Aromatic	96	86.50%	12.50%	1.04%	0.00%	NA
Intermediate	90	58.90%	32.20%	4.44%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1226816132	C -> DEL	LOC_Os12g43179.1	N	frameshift_variant	Average:55.691; most accessible tissue: Zhenshan97 flag leaf, score: 83.526	N	N	N	N
vg1226816132	C -> T	LOC_Os12g43179.1	synonymous_variant ; p.Ala468Ala; LOW	synonymous_codon	Average:55.691; most accessible tissue: Zhenshan97 flag leaf, score: 83.526	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1226816132	NA	6.26E-07	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	4.86E-06	mr1188	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	3.05E-11	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	5.56E-08	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	1.78E-07	1.62E-41	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	4.21E-07	2.44E-19	mr1855	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	8.47E-11	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	1.56E-06	mr1168_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	2.01E-06	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	8.15E-13	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	9.29E-09	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	4.83E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	6.93E-08	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	2.35E-11	mr1610_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	7.35E-06	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	1.61E-16	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	2.63E-08	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	2.38E-06	1.89E-43	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	5.51E-07	1.28E-17	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	1.28E-12	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	8.25E-06	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	3.87E-18	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	5.15E-11	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	2.56E-18	mr1927_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816132	NA	2.23E-08	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251