\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226816127:

Variant ID: vg1226816127 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 26816127
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:


CTCCCCGCAGTTGAAGCAGTCCACATTCTTCTTGACTCCAGGGGCAGCCAGGGTTGGTGTAGGGGTGCGGTTCTGAACCGCAACTGGCCTATTGAAATTG[C/T]
TAGGCGCAGCGGGACGGTTGGTTGCCACAATAGTGGGCTTCCGTCCAGACGAAGTGGCCCCCTTGAGTCGCTGAGGTACTCCCTGAGGCGGGCGATTCAT

Reverse complement sequence

ATGAATCGCCCGCCTCAGGGAGTACCTCAGCGACTCAAGGGGGCCACTTCGTCTGGACGGAAGCCCACTATTGTGGCAACCAACCGTCCCGCTGCGCCTA[G/A]
CAATTTCAATAGGCCAGTTGCGGTTCAGAACCGCACCCCTACACCAACCCTGGCTGCCCCTGGAGTCAAGAAGAATGTGGACTGCTTCAACTGCGGGGAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.30% 41.70% 5.65% 1.35% NA
All Indica  2759 30.00% 61.40% 8.16% 0.51% NA
All Japonica  1512 94.80% 0.10% 1.98% 3.04% NA
Aus  269 9.30% 90.30% 0.37% 0.00% NA
Indica I  595 69.10% 27.20% 3.36% 0.34% NA
Indica II  465 15.70% 71.80% 11.40% 1.08% NA
Indica III  913 15.70% 74.40% 9.53% 0.44% NA
Indica Intermediate  786 25.40% 65.90% 8.27% 0.38% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 86.10% 0.20% 5.56% 8.13% NA
Japonica Intermediate  241 96.70% 0.40% 0.83% 2.07% NA
VI/Aromatic  96 86.50% 11.50% 2.08% 0.00% NA
Intermediate  90 60.00% 25.60% 10.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1226816127 C -> DEL LOC_Os12g43179.1 N frameshift_variant Average:55.389; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 N N N N
vg1226816127 C -> T LOC_Os12g43179.1 missense_variant ; p.Ser470Asn; MODERATE nonsynonymous_codon ; S470N Average:55.389; most accessible tissue: Zhenshan97 flag leaf, score: 83.526 unknown unknown TOLERATED 0.41

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1226816127 NA 2.03E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 3.12E-06 mr1188 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 2.24E-11 mr1317 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 8.23E-09 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 8.34E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 1.09E-07 1.91E-41 mr1855 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 4.28E-07 4.26E-20 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 8.61E-12 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 8.73E-11 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 2.06E-06 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 1.51E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 5.56E-13 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 2.78E-09 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 4.05E-06 mr1322_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 4.30E-08 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 7.42E-06 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 1.35E-16 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 8.41E-09 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 1.45E-06 8.56E-43 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 1.58E-07 8.70E-19 mr1855_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 1.36E-12 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 5.14E-06 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 2.53E-17 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 4.52E-11 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 3.82E-18 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127 NA 6.38E-09 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251