Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226816127:

Variant ID: vg1226816127 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 26816127
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 88. )

Flanking Sequence (100 bp) in Reference Genome:

CTCCCCGCAGTTGAAGCAGTCCACATTCTTCTTGACTCCAGGGGCAGCCAGGGTTGGTGTAGGGGTGCGGTTCTGAACCGCAACTGGCCTATTGAAATTG[C/T]
TAGGCGCAGCGGGACGGTTGGTTGCCACAATAGTGGGCTTCCGTCCAGACGAAGTGGCCCCCTTGAGTCGCTGAGGTACTCCCTGAGGCGGGCGATTCAT

Reverse complement sequence

ATGAATCGCCCGCCTCAGGGAGTACCTCAGCGACTCAAGGGGGCCACTTCGTCTGGACGGAAGCCCACTATTGTGGCAACCAACCGTCCCGCTGCGCCTA[G/A]
CAATTTCAATAGGCCAGTTGCGGTTCAGAACCGCACCCCTACACCAACCCTGGCTGCCCCTGGAGTCAAGAAGAATGTGGACTGCTTCAACTGCGGGGAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.30%	41.70%	5.65%	1.35%	NA
All Indica	2759	30.00%	61.40%	8.16%	0.51%	NA
All Japonica	1512	94.80%	0.10%	1.98%	3.04%	NA
Aus	269	9.30%	90.30%	0.37%	0.00%	NA
Indica I	595	69.10%	27.20%	3.36%	0.34%	NA
Indica II	465	15.70%	71.80%	11.40%	1.08%	NA
Indica III	913	15.70%	74.40%	9.53%	0.44%	NA
Indica Intermediate	786	25.40%	65.90%	8.27%	0.38%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	86.10%	0.20%	5.56%	8.13%	NA
Japonica Intermediate	241	96.70%	0.40%	0.83%	2.07%	NA
VI/Aromatic	96	86.50%	11.50%	2.08%	0.00%	NA
Intermediate	90	60.00%	25.60%	10.00%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1226816127	C -> DEL	LOC_Os12g43179.1	N	frameshift_variant	Average:55.389; most accessible tissue: Zhenshan97 flag leaf, score: 83.526	N	N	N	N
vg1226816127	C -> T	LOC_Os12g43179.1	missense_variant ; p.Ser470Asn; MODERATE	nonsynonymous_codon ; S470N	Average:55.389; most accessible tissue: Zhenshan97 flag leaf, score: 83.526	unknown	unknown	TOLERATED	0.41

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1226816127	NA	2.03E-06	mr1170	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	3.12E-06	mr1188	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	2.24E-11	mr1317	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	8.23E-09	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	8.34E-06	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	1.09E-07	1.91E-41	mr1855	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	4.28E-07	4.26E-20	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	8.61E-12	mr1897	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	8.73E-11	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	2.06E-06	mr1168_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	1.51E-06	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	5.56E-13	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	2.78E-09	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	4.05E-06	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	4.30E-08	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	7.42E-06	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	1.35E-16	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	8.41E-09	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	1.45E-06	8.56E-43	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	1.58E-07	8.70E-19	mr1855_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	1.36E-12	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	5.14E-06	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	2.53E-17	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	4.52E-11	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	3.82E-18	mr1927_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226816127	NA	6.38E-09	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251