Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226750394:

Variant ID: vg1226750394 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 26750394
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:

ATAATTTACAACATTTGCTCAAATTTAAACTCTTGGAGTATTTTGCAGAGCAAGGAGGGAGACAAAGGAAGAATGCAGTGGGGGCGCAGCTACTAAGGCA[G/A]
GTAGCAAATGAGATCTTTCACTCAAAATTTGGATGGAGGGGCGGCAGACAAAGAATAGGATGTGAAACAGAGAGAGGCAGGCTAAACTAATGGCAAGAAG

Reverse complement sequence

CTTCTTGCCATTAGTTTAGCCTGCCTCTCTCTGTTTCACATCCTATTCTTTGTCTGCCGCCCCTCCATCCAAATTTTGAGTGAAAGATCTCATTTGCTAC[C/T]
TGCCTTAGTAGCTGCGCCCCCACTGCATTCTTCCTTTGTCTCCCTCCTTGCTCTGCAAAATACTCCAAGAGTTTAAATTTGAGCAAATGTTGTAAATTAT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.70%	6.10%	0.15%	0.00%	NA
All Indica	2759	97.90%	2.10%	0.04%	0.00%	NA
All Japonica	1512	100.00%	0.00%	0.00%	0.00%	NA
Aus	269	20.80%	77.00%	2.23%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	97.00%	3.00%	0.00%	0.00%	NA
Indica Intermediate	786	96.10%	3.80%	0.13%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	83.30%	16.70%	0.00%	0.00%	NA
Intermediate	90	90.00%	10.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1226750394	G -> A	LOC_Os12g43070.1	upstream_gene_variant ; 1790.0bp to feature; MODIFIER	silent_mutation	Average:53.596; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg1226750394	G -> A	LOC_Os12g43080.1	upstream_gene_variant ; 3078.0bp to feature; MODIFIER	silent_mutation	Average:53.596; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg1226750394	G -> A	LOC_Os12g43060.1	downstream_gene_variant ; 5.0bp to feature; MODIFIER	silent_mutation	Average:53.596; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N
vg1226750394	G -> A	LOC_Os12g43060-LOC_Os12g43070	intergenic_region ; MODIFIER	silent_mutation	Average:53.596; most accessible tissue: Minghui63 panicle, score: 75.788	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1226750394	NA	8.47E-07	mr1006	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	1.07E-06	mr1052	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	6.65E-06	mr1073	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	3.01E-06	mr1126	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	2.64E-14	mr1166	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	1.94E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	5.45E-25	mr1210	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	5.43E-17	mr1231	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	5.47E-11	mr1232	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	6.56E-29	mr1305	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	1.89E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	2.20E-13	mr1409	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	7.28E-22	mr1515	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	5.88E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	1.78E-29	mr1586	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	2.59E-06	2.60E-16	mr1649	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	1.88E-11	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	1.32E-08	mr1762	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	3.74E-18	mr1765	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	2.36E-06	mr1774	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	5.61E-06	mr1344_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	2.02E-20	mr1587_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	1.47E-07	mr1642_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	1.84E-06	mr1743_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	3.65E-07	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226750394	NA	2.07E-09	mr1860_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251