Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1226678487:

Variant ID: vg1226678487 (JBrowse)Variation Type: SNP
Chromosome: chr12Position: 26678487
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AACTGCGAGAAGCGAGCGGGAGGAGGCGAGAGGCGAAAGGGGAGGGGAGACGAGCGGGAGGGAGCGGAAATTTCGAGTTCGTTGGGCTATTGGCTACTTG[C/T]
TGAGCTGTCCTTTCGTTTTGTCTACCCGGTCCGGATGGGGCCTTGTGGGTTTTTCACTTTTTCTTTTTCTTTCCTTTTCTCTCTCTCTGTTTTTTTTTGT

Reverse complement sequence

ACAAAAAAAAACAGAGAGAGAGAAAAGGAAAGAAAAAGAAAAAGTGAAAAACCCACAAGGCCCCATCCGGACCGGGTAGACAAAACGAAAGGACAGCTCA[G/A]
CAAGTAGCCAATAGCCCAACGAACTCGAAATTTCCGCTCCCTCCCGCTCGTCTCCCCTCCCCTTTCGCCTCTCGCCTCCTCCCGCTCGCTTCTCGCAGTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.30% 5.80% 4.93% 0.00% NA
All Indica  2759 96.20% 1.30% 2.46% 0.00% NA
All Japonica  1512 74.30% 15.30% 10.45% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 86.90% 3.20% 9.92% 0.00% NA
Indica II  465 98.10% 1.90% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 1.10% 1.15% 0.00% NA
Temperate Japonica  767 57.60% 26.20% 16.17% 0.00% NA
Tropical Japonica  504 93.80% 2.80% 3.37% 0.00% NA
Japonica Intermediate  241 86.30% 6.60% 7.05% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 85.60% 7.80% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1226678487 C -> T LOC_Os12g42930.1 upstream_gene_variant ; 134.0bp to feature; MODIFIER silent_mutation Average:88.797; most accessible tissue: Minghui63 flag leaf, score: 97.049 N N N N
vg1226678487 C -> T LOC_Os12g42940.1 upstream_gene_variant ; 2665.0bp to feature; MODIFIER silent_mutation Average:88.797; most accessible tissue: Minghui63 flag leaf, score: 97.049 N N N N
vg1226678487 C -> T LOC_Os12g42920.1 downstream_gene_variant ; 4744.0bp to feature; MODIFIER silent_mutation Average:88.797; most accessible tissue: Minghui63 flag leaf, score: 97.049 N N N N
vg1226678487 C -> T LOC_Os12g42930-LOC_Os12g42940 intergenic_region ; MODIFIER silent_mutation Average:88.797; most accessible tissue: Minghui63 flag leaf, score: 97.049 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1226678487 C T -0.05 -0.02 0.0 -0.04 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1226678487 2.83E-06 2.14E-08 mr1182 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226678487 NA 8.72E-06 mr1282 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226678487 3.63E-06 5.40E-08 mr1650 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251