Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1226678487:

Variant ID: vg1226678487 (JBrowse)	Variation Type: SNP
Chromosome: chr12	Position: 26678487
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACTGCGAGAAGCGAGCGGGAGGAGGCGAGAGGCGAAAGGGGAGGGGAGACGAGCGGGAGGGAGCGGAAATTTCGAGTTCGTTGGGCTATTGGCTACTTG[C/T]
TGAGCTGTCCTTTCGTTTTGTCTACCCGGTCCGGATGGGGCCTTGTGGGTTTTTCACTTTTTCTTTTTCTTTCCTTTTCTCTCTCTCTGTTTTTTTTTGT

Reverse complement sequence

ACAAAAAAAAACAGAGAGAGAGAAAAGGAAAGAAAAAGAAAAAGTGAAAAACCCACAAGGCCCCATCCGGACCGGGTAGACAAAACGAAAGGACAGCTCA[G/A]
CAAGTAGCCAATAGCCCAACGAACTCGAAATTTCCGCTCCCTCCCGCTCGTCTCCCCTCCCCTTTCGCCTCTCGCCTCCTCCCGCTCGCTTCTCGCAGTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	89.30%	5.80%	4.93%	0.00%	NA
All Indica	2759	96.20%	1.30%	2.46%	0.00%	NA
All Japonica	1512	74.30%	15.30%	10.45%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	86.90%	3.20%	9.92%	0.00%	NA
Indica II	465	98.10%	1.90%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	1.10%	1.15%	0.00%	NA
Temperate Japonica	767	57.60%	26.20%	16.17%	0.00%	NA
Tropical Japonica	504	93.80%	2.80%	3.37%	0.00%	NA
Japonica Intermediate	241	86.30%	6.60%	7.05%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	85.60%	7.80%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1226678487	C -> T	LOC_Os12g42930.1	upstream_gene_variant ; 134.0bp to feature; MODIFIER	silent_mutation	Average:88.797; most accessible tissue: Minghui63 flag leaf, score: 97.049	N	N	N	N
vg1226678487	C -> T	LOC_Os12g42940.1	upstream_gene_variant ; 2665.0bp to feature; MODIFIER	silent_mutation	Average:88.797; most accessible tissue: Minghui63 flag leaf, score: 97.049	N	N	N	N
vg1226678487	C -> T	LOC_Os12g42920.1	downstream_gene_variant ; 4744.0bp to feature; MODIFIER	silent_mutation	Average:88.797; most accessible tissue: Minghui63 flag leaf, score: 97.049	N	N	N	N
vg1226678487	C -> T	LOC_Os12g42930-LOC_Os12g42940	intergenic_region ; MODIFIER	silent_mutation	Average:88.797; most accessible tissue: Minghui63 flag leaf, score: 97.049	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1226678487	C	T	-0.05	-0.02	0.0	-0.04	-0.03	-0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1226678487	2.83E-06	2.14E-08	mr1182	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226678487	NA	8.72E-06	mr1282	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1226678487	3.63E-06	5.40E-08	mr1650	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251